Mutagenetix > Incidental Mutations

Incidental Mutation 'R6000:Ino80'

480761

Institutional Source

Beutler Lab

Gene Symbol

Ino80

Ensembl Gene

ENSMUSG00000034154

Gene Name

INO80 complex subunit

Synonyms

INO80, 2310079N15Rik, 4632409L19Rik, Inoc1

MMRRC Submission

044179-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.962) question?

Stock #

R6000 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

119373042-119477687 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 119374508 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 1512 (S1512R)

Ref Sequence

ENSEMBL: ENSMUSP00000051845 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049920]

Predicted Effect

probably benign
Transcript: ENSMUST00000049920
AA Change: S1512R

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000051845
Gene: ENSMUSG00000034154
AA Change: S1512R

Domain	Start	End	E-Value	Type
coiled coil region	131	165	N/A	INTRINSIC
low complexity region	206	242	N/A	INTRINSIC
Pfam:DBINO	275	407	6.6e-50	PFAM
low complexity region	474	489	N/A	INTRINSIC
DEXDc	516	714	6.27e-37	SMART
low complexity region	907	923	N/A	INTRINSIC
HELICc	1134	1217	2.86e-22	SMART
low complexity region	1270	1324	N/A	INTRINSIC
low complexity region	1357	1368	N/A	INTRINSIC
low complexity region	1424	1436	N/A	INTRINSIC
low complexity region	1438	1450	N/A	INTRINSIC
low complexity region	1457	1483	N/A	INTRINSIC
low complexity region	1510	1521	N/A	INTRINSIC

Meta Mutation Damage Score

0.0776

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 91.7%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the chromatin remodeling complex, which is classified into subfamilies depending on sequence features apart from the conserved ATPase domain. This protein is the catalytic ATPase subunit of the INO80 chromatin remodeling complex, which is characterized by a DNA-binding domain. This protein is proposed to bind DNA and be recruited by the YY1 transcription factor to activate certain genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Embryos homozygous for a knock-out allele die around E7.5 and show absence of anterior and distal visceral endoderm. Another null allele results in embryonic lethality by E13.5-E14.5 with severe growth retardation and developmental defects. Heterozygotes show defects in hindlimb extension reflex. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310034C09Rik	T	C	16: 88,759,539	C214R	possibly damaging	Het
5430403G16Rik	A	G	5: 109,676,864	V240A	probably benign	Het
Ahnak	A	T	19: 9,013,111	K3920*	probably null	Het
Alox12b	A	G	11: 69,169,568	D650G	probably damaging	Het
Amt	A	T	9: 108,301,485	Y400F	probably benign	Het
Ankrd11	A	G	8: 122,891,195	S1973P	possibly damaging	Het
Aoc1	A	T	6: 48,907,639	T539S	probably benign	Het
Arhgap44	CTGCT	CTGCTTGCT	11: 65,032,084		probably null	Het
Ccdc15	C	T	9: 37,315,764	G292S	probably benign	Het
Ccdc162	C	T	10: 41,561,163	C287Y	possibly damaging	Het
Cdk15	G	A	1: 59,289,659	G244D	probably damaging	Het
Cep290	T	A	10: 100,541,787	Y1560N	probably damaging	Het
Cic	A	C	7: 25,271,998	I385L	probably benign	Het
Cobl	A	T	11: 12,369,684	F231L	probably benign	Het
Cpeb1	T	C	7: 81,361,680	D171G	possibly damaging	Het
Csnk1g2	T	A	10: 80,638,944	V305E	probably damaging	Het
Cyp2c29	A	G	19: 39,307,606		probably null	Het
Dner	A	T	1: 84,383,929	M653K	possibly damaging	Het
Dst	T	A	1: 34,212,223	M4311K	possibly damaging	Het
Ep400	A	G	5: 110,683,201	S2200P	unknown	Het
Ephb2	A	T	4: 136,684,030	S440T	possibly damaging	Het
Ercc1	A	T	7: 19,347,161		probably benign	Het
Folh1	T	A	7: 86,725,934	N615Y	probably benign	Het
Gm35911	G	T	5: 99,941,367	A164S	probably benign	Het
Gm7298	T	C	6: 121,765,079	Y487H	possibly damaging	Het
Gucy1b2	A	T	14: 62,419,050	I286N	probably benign	Het
Hr	A	G	14: 70,567,833	D1005G	probably damaging	Het
Ifrd1	C	A	12: 40,216,244	V117F	possibly damaging	Het
Ift140	A	T	17: 25,036,960	T210S	probably benign	Het
Igll1	C	A	16: 16,863,941		probably benign	Het
Intu	A	T	3: 40,654,148	K197*	probably null	Het
Kdm6b	A	G	11: 69,403,598	L1216P	unknown	Het
Klrb1c	T	G	6: 128,784,157	D169A	probably damaging	Het
Lamp3	T	A	16: 19,700,948	T162S	possibly damaging	Het
Mapk10	G	A	5: 102,966,475	P319L	probably damaging	Het
Mapk10	G	A	5: 102,966,476	P319S	probably damaging	Het
Mical3	T	C	6: 121,021,320	T702A	probably benign	Het
Mstn	C	T	1: 53,061,669		probably benign	Het
Nckap1l	T	C	15: 103,478,815	S706P	probably benign	Het
Nckap5l	G	A	15: 99,426,885	T579I	probably damaging	Het
Olfr1197	C	A	2: 88,729,231	A123S	probably damaging	Het
Olfr1341	A	T	4: 118,710,244	N279I	probably damaging	Het
Olfr285	G	A	15: 98,313,436	T38I	probably benign	Het
Pcdh18	A	C	3: 49,754,464	S801A	probably damaging	Het
Pde11a	A	T	2: 76,017,860	D874E	probably damaging	Het
Pfdn6	G	T	17: 33,939,615	P62T	probably damaging	Het
Pkd1l1	A	G	11: 8,950,427	I38T	probably benign	Het
Prkdc	A	T	16: 15,829,697	I3662F	possibly damaging	Het
Psg26	A	T	7: 18,482,692	L74*	probably null	Het
Rassf6	A	G	5: 90,603,877	V341A	probably damaging	Het
Rsad2	C	A	12: 26,447,151		probably null	Het
Rwdd3	A	G	3: 121,156,513	Y95H	probably damaging	Het
Scfd1	A	G	12: 51,445,674	I589V	possibly damaging	Het
Sgsm1	A	T	5: 113,286,838	I131N	probably damaging	Het
Tecpr1	A	G	5: 144,211,421	S389P	probably benign	Het
Tle3	T	A	9: 61,374,014	I29N	probably damaging	Het
Tmem63c	C	A	12: 87,057,197	N73K	probably damaging	Het
Tpm2	T	A	4: 43,518,301		probably null	Het
Trak2	A	T	1: 58,911,812	D405E	possibly damaging	Het
Ttn	C	A	2: 76,745,172	A23380S	probably damaging	Het
Ttn	A	T	2: 76,885,151		probably benign	Het
Tub	T	C	7: 109,029,650	S391P	probably damaging	Het
Ush2a	G	T	1: 188,267,026	E178*	probably null	Het
Wdr66	A	G	5: 123,254,372		probably benign	Het
Wisp3	T	C	10: 39,158,300	Y102C	probably damaging	Het
Ylpm1	C	A	12: 84,997,256	T256K	unknown	Het

Other mutations in Ino80

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01402:Ino80	APN	2	119456718	missense	possibly damaging	0.83
IGL01404:Ino80	APN	2	119456718	missense	possibly damaging	0.83
IGL01985:Ino80	APN	2	119433321	missense	probably damaging	0.99
IGL02039:Ino80	APN	2	119380073	missense	probably damaging	1.00
IGL02187:Ino80	APN	2	119445457	splice site	probably benign
IGL02726:Ino80	APN	2	119442483	missense	probably damaging	1.00
chosen	UTSW	2	119382269	splice site	probably null
PIT4677001:Ino80	UTSW	2	119377545	missense	probably benign
R0004:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0004:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0057:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0113:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0114:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0115:Ino80	UTSW	2	119431016	missense	probably damaging	1.00
R0138:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0189:Ino80	UTSW	2	119379679	missense	probably benign	0.36
R0363:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0364:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0365:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0481:Ino80	UTSW	2	119431016	missense	probably damaging	1.00
R0532:Ino80	UTSW	2	119381983	missense	possibly damaging	0.79
R0580:Ino80	UTSW	2	119383481	missense	probably damaging	1.00
R0610:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0675:Ino80	UTSW	2	119383481	missense	probably damaging	1.00
R1275:Ino80	UTSW	2	119427055	missense	probably benign	0.12
R1470:Ino80	UTSW	2	119379649	missense	probably damaging	1.00
R1470:Ino80	UTSW	2	119379649	missense	probably damaging	1.00
R1506:Ino80	UTSW	2	119425265	nonsense	probably null
R1510:Ino80	UTSW	2	119450049	missense	probably damaging	1.00
R1570:Ino80	UTSW	2	119447028	missense	possibly damaging	0.68
R1613:Ino80	UTSW	2	119392867	missense	probably damaging	1.00
R1673:Ino80	UTSW	2	119381936	missense	probably damaging	1.00
R1773:Ino80	UTSW	2	119418409	missense	probably benign	0.18
R1795:Ino80	UTSW	2	119406859	missense	probably damaging	1.00
R2093:Ino80	UTSW	2	119426670	missense	possibly damaging	0.55
R2105:Ino80	UTSW	2	119431929	missense	probably null	1.00
R2113:Ino80	UTSW	2	119454084	missense	probably damaging	1.00
R3618:Ino80	UTSW	2	119446872	missense	probably null	0.81
R4572:Ino80	UTSW	2	119402358	missense	probably damaging	1.00
R4649:Ino80	UTSW	2	119431008	missense	probably damaging	1.00
R4919:Ino80	UTSW	2	119442592	missense	probably damaging	1.00
R5113:Ino80	UTSW	2	119431945	missense	probably damaging	1.00
R5138:Ino80	UTSW	2	119383421	missense	probably damaging	1.00
R5458:Ino80	UTSW	2	119412429	missense	possibly damaging	0.50
R5499:Ino80	UTSW	2	119441647	missense	probably damaging	1.00
R5502:Ino80	UTSW	2	119402396	missense	probably damaging	1.00
R5531:Ino80	UTSW	2	119445575	missense	probably benign
R5740:Ino80	UTSW	2	119431029	missense	probably damaging	1.00
R5892:Ino80	UTSW	2	119439547	intron	probably benign
R5914:Ino80	UTSW	2	119458216	missense	probably damaging	0.99
R6263:Ino80	UTSW	2	119383414	missense	probably damaging	1.00
R6505:Ino80	UTSW	2	119451441	missense	probably damaging	1.00
R6942:Ino80	UTSW	2	119383502	missense	probably damaging	0.99
R7052:Ino80	UTSW	2	119426587	critical splice donor site	probably null
R7100:Ino80	UTSW	2	119374513	missense	possibly damaging	0.47
R7163:Ino80	UTSW	2	119392875	missense	probably damaging	1.00
R7187:Ino80	UTSW	2	119426591	missense	probably benign	0.00
R7202:Ino80	UTSW	2	119374437	missense	probably benign	0.00
R7218:Ino80	UTSW	2	119458127	missense	probably benign
R7389:Ino80	UTSW	2	119442529	missense	probably benign	0.00
R7419:Ino80	UTSW	2	119380014	missense	probably benign	0.00
R7437:Ino80	UTSW	2	119442586	missense	possibly damaging	0.86
R7607:Ino80	UTSW	2	119382269	splice site	probably null
R7702:Ino80	UTSW	2	119442573	missense	probably benign	0.01
R7975:Ino80	UTSW	2	119456467	splice site	probably null
R7978:Ino80	UTSW	2	119439393	missense	possibly damaging	0.93
R8376:Ino80	UTSW	2	119442487	missense	probably benign	0.14
R8469:Ino80	UTSW	2	119379593	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CTAGAGGGCAGAGATGGTTACC -3'
(R):5'- TGTCAGACATGTGCCCTCTC -3'

Sequencing Primer
(F):5'- CAGAGATGGTTACCATGGTTACC -3'
(R):5'- TCTCCAGAGCCTGAAGAGTATGTC -3'

Posted On

2017-06-26