Incidental Mutation 'R6000:Intu'
ID 480762
Institutional Source Beutler Lab
Gene Symbol Intu
Ensembl Gene ENSMUSG00000060798
Gene Name inturned planar cell polarity protein
Synonyms Pdzk6, 9230116I04Rik, Pdzd6, 9430087H23Rik
MMRRC Submission 044179-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6000 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 40585559-40659206 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 40608578 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 197 (K197*)
Ref Sequence ENSEMBL: ENSMUSP00000088725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061590] [ENSMUST00000091186]
AlphaFold Q059U7
Predicted Effect probably null
Transcript: ENSMUST00000061590
AA Change: K179*
SMART Domains Protein: ENSMUSP00000054313
Gene: ENSMUSG00000060798
AA Change: K179*

DomainStartEndE-ValueType
low complexity region 46 63 N/A INTRINSIC
Blast:PDZ 134 214 2e-25 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000091186
AA Change: K197*
SMART Domains Protein: ENSMUSP00000088725
Gene: ENSMUSG00000060798
AA Change: K197*

DomainStartEndE-ValueType
low complexity region 21 48 N/A INTRINSIC
low complexity region 64 81 N/A INTRINSIC
PDZ 187 269 2.09e-3 SMART
low complexity region 459 468 N/A INTRINSIC
low complexity region 774 784 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161930
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency 100% (64/64)
MGI Phenotype PHENOTYPE: Homozygous null mice show defective ciliogenesis and neural tube closure, abnormal patterning of the CNS and limbs, polydactyly, edema and death by E16.5. Homozygotes for a hypomorphic allele show defective ciliation and endochondral ossification, stunted growth, polydactyly and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik T C 16: 88,556,427 (GRCm39) C214R possibly damaging Het
Ahnak A T 19: 8,990,475 (GRCm39) K3920* probably null Het
Alox12b A G 11: 69,060,394 (GRCm39) D650G probably damaging Het
Amt A T 9: 108,178,684 (GRCm39) Y400F probably benign Het
Ankrd11 A G 8: 123,617,934 (GRCm39) S1973P possibly damaging Het
Aoc1 A T 6: 48,884,573 (GRCm39) T539S probably benign Het
Arhgap44 CTGCT CTGCTTGCT 11: 64,922,910 (GRCm39) probably null Het
Ccdc15 C T 9: 37,227,060 (GRCm39) G292S probably benign Het
Ccdc162 C T 10: 41,437,159 (GRCm39) C287Y possibly damaging Het
Ccn6 T C 10: 39,034,296 (GRCm39) Y102C probably damaging Het
Cdk15 G A 1: 59,328,818 (GRCm39) G244D probably damaging Het
Cep290 T A 10: 100,377,649 (GRCm39) Y1560N probably damaging Het
Cfap251 A G 5: 123,392,435 (GRCm39) probably benign Het
Cic A C 7: 24,971,423 (GRCm39) I385L probably benign Het
Cobl A T 11: 12,319,684 (GRCm39) F231L probably benign Het
Cpeb1 T C 7: 81,011,428 (GRCm39) D171G possibly damaging Het
Csnk1g2 T A 10: 80,474,778 (GRCm39) V305E probably damaging Het
Cyp2c29 A G 19: 39,296,050 (GRCm39) probably null Het
Dner A T 1: 84,361,650 (GRCm39) M653K possibly damaging Het
Dst T A 1: 34,251,304 (GRCm39) M4311K possibly damaging Het
Ep400 A G 5: 110,831,067 (GRCm39) S2200P unknown Het
Ephb2 A T 4: 136,411,341 (GRCm39) S440T possibly damaging Het
Ercc1 A T 7: 19,081,086 (GRCm39) probably benign Het
Folh1 T A 7: 86,375,142 (GRCm39) N615Y probably benign Het
Gm7298 T C 6: 121,742,038 (GRCm39) Y487H possibly damaging Het
Gucy1b2 A T 14: 62,656,499 (GRCm39) I286N probably benign Het
Hr A G 14: 70,805,273 (GRCm39) D1005G probably damaging Het
Ifrd1 C A 12: 40,266,243 (GRCm39) V117F possibly damaging Het
Ift140 A T 17: 25,255,934 (GRCm39) T210S probably benign Het
Igll1 C A 16: 16,681,805 (GRCm39) probably benign Het
Ino80 G T 2: 119,204,989 (GRCm39) S1512R probably benign Het
Kdm6b A G 11: 69,294,424 (GRCm39) L1216P unknown Het
Klrb1c T G 6: 128,761,120 (GRCm39) D169A probably damaging Het
Lamp3 T A 16: 19,519,698 (GRCm39) T162S possibly damaging Het
Mapk10 G A 5: 103,114,342 (GRCm39) P319S probably damaging Het
Mapk10 G A 5: 103,114,341 (GRCm39) P319L probably damaging Het
Mical3 T C 6: 120,998,281 (GRCm39) T702A probably benign Het
Mstn C T 1: 53,100,828 (GRCm39) probably benign Het
Nckap1l T C 15: 103,387,242 (GRCm39) S706P probably benign Het
Nckap5l G A 15: 99,324,766 (GRCm39) T579I probably damaging Het
Or13p3 A T 4: 118,567,441 (GRCm39) N279I probably damaging Het
Or4a27 C A 2: 88,559,575 (GRCm39) A123S probably damaging Het
Or8s16 G A 15: 98,211,317 (GRCm39) T38I probably benign Het
Pcdh18 A C 3: 49,708,913 (GRCm39) S801A probably damaging Het
Pde11a A T 2: 75,848,204 (GRCm39) D874E probably damaging Het
Pfdn6 G T 17: 34,158,589 (GRCm39) P62T probably damaging Het
Pkd1l1 A G 11: 8,900,427 (GRCm39) I38T probably benign Het
Prkdc A T 16: 15,647,561 (GRCm39) I3662F possibly damaging Het
Psg26 A T 7: 18,216,617 (GRCm39) L74* probably null Het
Rassf6 A G 5: 90,751,736 (GRCm39) V341A probably damaging Het
Rsad2 C A 12: 26,497,150 (GRCm39) probably null Het
Rwdd3 A G 3: 120,950,162 (GRCm39) Y95H probably damaging Het
Scfd1 A G 12: 51,492,457 (GRCm39) I589V possibly damaging Het
Sgsm1 A T 5: 113,434,704 (GRCm39) I131N probably damaging Het
Tecpr1 A G 5: 144,148,239 (GRCm39) S389P probably benign Het
Tle3 T A 9: 61,281,296 (GRCm39) I29N probably damaging Het
Tmem63c C A 12: 87,103,971 (GRCm39) N73K probably damaging Het
Tpm2 T A 4: 43,518,301 (GRCm39) probably null Het
Trak2 A T 1: 58,950,971 (GRCm39) D405E possibly damaging Het
Ttn C A 2: 76,575,516 (GRCm39) A23380S probably damaging Het
Ttn A T 2: 76,715,495 (GRCm39) probably benign Het
Tub T C 7: 108,628,857 (GRCm39) S391P probably damaging Het
Ush2a G T 1: 187,999,223 (GRCm39) E178* probably null Het
Vamp9 G T 5: 100,089,226 (GRCm39) A164S probably benign Het
Ylpm1 C A 12: 85,044,030 (GRCm39) T256K unknown Het
Zfp1007 A G 5: 109,824,730 (GRCm39) V240A probably benign Het
Other mutations in Intu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Intu APN 3 40,618,696 (GRCm39) missense probably benign 0.12
IGL01386:Intu APN 3 40,647,017 (GRCm39) missense probably damaging 1.00
IGL02645:Intu APN 3 40,655,702 (GRCm39) missense probably benign 0.01
IGL02869:Intu APN 3 40,642,216 (GRCm39) missense probably damaging 1.00
IGL03263:Intu APN 3 40,627,027 (GRCm39) nonsense probably null
H8562:Intu UTSW 3 40,647,103 (GRCm39) missense probably damaging 1.00
PIT4495001:Intu UTSW 3 40,652,033 (GRCm39) missense probably benign 0.07
R0010:Intu UTSW 3 40,608,702 (GRCm39) intron probably benign
R0173:Intu UTSW 3 40,629,776 (GRCm39) critical splice donor site probably null
R0426:Intu UTSW 3 40,629,735 (GRCm39) missense probably damaging 0.97
R1566:Intu UTSW 3 40,647,008 (GRCm39) missense probably damaging 0.99
R1619:Intu UTSW 3 40,652,061 (GRCm39) nonsense probably null
R1658:Intu UTSW 3 40,647,211 (GRCm39) missense probably benign 0.20
R1701:Intu UTSW 3 40,618,694 (GRCm39) missense probably damaging 1.00
R1707:Intu UTSW 3 40,637,931 (GRCm39) missense possibly damaging 0.69
R1707:Intu UTSW 3 40,595,073 (GRCm39) missense probably benign 0.03
R1867:Intu UTSW 3 40,618,765 (GRCm39) missense probably damaging 1.00
R1868:Intu UTSW 3 40,618,765 (GRCm39) missense probably damaging 1.00
R2090:Intu UTSW 3 40,637,966 (GRCm39) missense probably benign 0.00
R2310:Intu UTSW 3 40,608,243 (GRCm39) missense probably benign
R2989:Intu UTSW 3 40,647,140 (GRCm39) missense probably benign 0.11
R4168:Intu UTSW 3 40,627,053 (GRCm39) missense probably benign 0.00
R4530:Intu UTSW 3 40,637,794 (GRCm39) missense possibly damaging 0.95
R5093:Intu UTSW 3 40,647,347 (GRCm39) missense probably benign 0.00
R5541:Intu UTSW 3 40,647,017 (GRCm39) splice site probably null
R5587:Intu UTSW 3 40,629,738 (GRCm39) missense probably damaging 0.99
R5745:Intu UTSW 3 40,647,402 (GRCm39) splice site probably null
R5809:Intu UTSW 3 40,634,020 (GRCm39) missense probably damaging 0.99
R5939:Intu UTSW 3 40,647,014 (GRCm39) missense probably damaging 1.00
R5953:Intu UTSW 3 40,633,980 (GRCm39) missense probably damaging 1.00
R6063:Intu UTSW 3 40,608,524 (GRCm39) missense probably damaging 0.97
R6245:Intu UTSW 3 40,629,756 (GRCm39) missense probably damaging 0.98
R6310:Intu UTSW 3 40,655,721 (GRCm39) nonsense probably null
R6353:Intu UTSW 3 40,608,138 (GRCm39) missense probably damaging 1.00
R6451:Intu UTSW 3 40,655,723 (GRCm39) missense possibly damaging 0.94
R6660:Intu UTSW 3 40,586,100 (GRCm39) missense probably benign 0.00
R6848:Intu UTSW 3 40,648,685 (GRCm39) missense probably benign 0.00
R7440:Intu UTSW 3 40,651,981 (GRCm39) missense probably benign 0.04
R7625:Intu UTSW 3 40,652,029 (GRCm39) missense probably benign
R7633:Intu UTSW 3 40,608,683 (GRCm39) missense probably damaging 1.00
R7798:Intu UTSW 3 40,646,359 (GRCm39) missense probably damaging 1.00
R7877:Intu UTSW 3 40,654,222 (GRCm39) missense probably benign 0.07
R7978:Intu UTSW 3 40,652,069 (GRCm39) missense probably damaging 1.00
R8319:Intu UTSW 3 40,608,202 (GRCm39) missense probably damaging 1.00
R8332:Intu UTSW 3 40,629,719 (GRCm39) missense probably benign 0.35
R8860:Intu UTSW 3 40,627,162 (GRCm39) missense probably benign 0.07
R8926:Intu UTSW 3 40,608,139 (GRCm39) missense possibly damaging 0.69
R8946:Intu UTSW 3 40,637,789 (GRCm39) missense possibly damaging 0.93
R9164:Intu UTSW 3 40,645,133 (GRCm39) missense probably damaging 1.00
R9191:Intu UTSW 3 40,646,941 (GRCm39) missense probably damaging 0.99
R9547:Intu UTSW 3 40,608,536 (GRCm39) missense probably benign
Z1177:Intu UTSW 3 40,651,946 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GCCCGTGTCCATTCTGAAAC -3'
(R):5'- TTCTAAGACCAGGGCATGTGG -3'

Sequencing Primer
(F):5'- CGTGTCCATTCTGAAACATCAG -3'
(R):5'- ACTTGGAGCCTGAAACTTCTG -3'
Posted On 2017-06-26