Incidental Mutation 'R6000:Intu'
ID480762
Institutional Source Beutler Lab
Gene Symbol Intu
Ensembl Gene ENSMUSG00000060798
Gene Nameinturned planar cell polarity protein
SynonymsPdzd6, Pdzk6, 9430087H23Rik, 9230116I04Rik
MMRRC Submission 044179-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6000 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location40531286-40704774 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 40654148 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 197 (K197*)
Ref Sequence ENSEMBL: ENSMUSP00000088725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061590] [ENSMUST00000091186]
Predicted Effect probably null
Transcript: ENSMUST00000061590
AA Change: K179*
SMART Domains Protein: ENSMUSP00000054313
Gene: ENSMUSG00000060798
AA Change: K179*

DomainStartEndE-ValueType
low complexity region 46 63 N/A INTRINSIC
Blast:PDZ 134 214 2e-25 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000091186
AA Change: K197*
SMART Domains Protein: ENSMUSP00000088725
Gene: ENSMUSG00000060798
AA Change: K197*

DomainStartEndE-ValueType
low complexity region 21 48 N/A INTRINSIC
low complexity region 64 81 N/A INTRINSIC
PDZ 187 269 2.09e-3 SMART
low complexity region 459 468 N/A INTRINSIC
low complexity region 774 784 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161930
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency 100% (64/64)
MGI Phenotype PHENOTYPE: Homozygous null mice show defective ciliogenesis and neural tube closure, abnormal patterning of the CNS and limbs, polydactyly, edema and death by E16.5. Homozygotes for a hypomorphic allele show defective ciliation and endochondral ossification, stunted growth, polydactyly and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik T C 16: 88,759,539 C214R possibly damaging Het
5430403G16Rik A G 5: 109,676,864 V240A probably benign Het
Ahnak A T 19: 9,013,111 K3920* probably null Het
Alox12b A G 11: 69,169,568 D650G probably damaging Het
Amt A T 9: 108,301,485 Y400F probably benign Het
Ankrd11 A G 8: 122,891,195 S1973P possibly damaging Het
Aoc1 A T 6: 48,907,639 T539S probably benign Het
Arhgap44 CTGCT CTGCTTGCT 11: 65,032,084 probably null Het
Ccdc15 C T 9: 37,315,764 G292S probably benign Het
Ccdc162 C T 10: 41,561,163 C287Y possibly damaging Het
Cdk15 G A 1: 59,289,659 G244D probably damaging Het
Cep290 T A 10: 100,541,787 Y1560N probably damaging Het
Cic A C 7: 25,271,998 I385L probably benign Het
Cobl A T 11: 12,369,684 F231L probably benign Het
Cpeb1 T C 7: 81,361,680 D171G possibly damaging Het
Csnk1g2 T A 10: 80,638,944 V305E probably damaging Het
Cyp2c29 A G 19: 39,307,606 probably null Het
Dner A T 1: 84,383,929 M653K possibly damaging Het
Dst T A 1: 34,212,223 M4311K possibly damaging Het
Ep400 A G 5: 110,683,201 S2200P unknown Het
Ephb2 A T 4: 136,684,030 S440T possibly damaging Het
Ercc1 A T 7: 19,347,161 probably benign Het
Folh1 T A 7: 86,725,934 N615Y probably benign Het
Gm35911 G T 5: 99,941,367 A164S probably benign Het
Gm7298 T C 6: 121,765,079 Y487H possibly damaging Het
Gucy1b2 A T 14: 62,419,050 I286N probably benign Het
Hr A G 14: 70,567,833 D1005G probably damaging Het
Ifrd1 C A 12: 40,216,244 V117F possibly damaging Het
Ift140 A T 17: 25,036,960 T210S probably benign Het
Igll1 C A 16: 16,863,941 probably benign Het
Ino80 G T 2: 119,374,508 S1512R probably benign Het
Kdm6b A G 11: 69,403,598 L1216P unknown Het
Klrb1c T G 6: 128,784,157 D169A probably damaging Het
Lamp3 T A 16: 19,700,948 T162S possibly damaging Het
Mapk10 G A 5: 102,966,475 P319L probably damaging Het
Mapk10 G A 5: 102,966,476 P319S probably damaging Het
Mical3 T C 6: 121,021,320 T702A probably benign Het
Mstn C T 1: 53,061,669 probably benign Het
Nckap1l T C 15: 103,478,815 S706P probably benign Het
Nckap5l G A 15: 99,426,885 T579I probably damaging Het
Olfr1197 C A 2: 88,729,231 A123S probably damaging Het
Olfr1341 A T 4: 118,710,244 N279I probably damaging Het
Olfr285 G A 15: 98,313,436 T38I probably benign Het
Pcdh18 A C 3: 49,754,464 S801A probably damaging Het
Pde11a A T 2: 76,017,860 D874E probably damaging Het
Pfdn6 G T 17: 33,939,615 P62T probably damaging Het
Pkd1l1 A G 11: 8,950,427 I38T probably benign Het
Prkdc A T 16: 15,829,697 I3662F possibly damaging Het
Psg26 A T 7: 18,482,692 L74* probably null Het
Rassf6 A G 5: 90,603,877 V341A probably damaging Het
Rsad2 C A 12: 26,447,151 probably null Het
Rwdd3 A G 3: 121,156,513 Y95H probably damaging Het
Scfd1 A G 12: 51,445,674 I589V possibly damaging Het
Sgsm1 A T 5: 113,286,838 I131N probably damaging Het
Tecpr1 A G 5: 144,211,421 S389P probably benign Het
Tle3 T A 9: 61,374,014 I29N probably damaging Het
Tmem63c C A 12: 87,057,197 N73K probably damaging Het
Tpm2 T A 4: 43,518,301 probably null Het
Trak2 A T 1: 58,911,812 D405E possibly damaging Het
Ttn C A 2: 76,745,172 A23380S probably damaging Het
Ttn A T 2: 76,885,151 probably benign Het
Tub T C 7: 109,029,650 S391P probably damaging Het
Ush2a G T 1: 188,267,026 E178* probably null Het
Wdr66 A G 5: 123,254,372 probably benign Het
Wisp3 T C 10: 39,158,300 Y102C probably damaging Het
Ylpm1 C A 12: 84,997,256 T256K unknown Het
Other mutations in Intu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Intu APN 3 40664266 missense probably benign 0.12
IGL01386:Intu APN 3 40692587 missense probably damaging 1.00
IGL02645:Intu APN 3 40701272 missense probably benign 0.01
IGL02869:Intu APN 3 40687786 missense probably damaging 1.00
IGL03263:Intu APN 3 40672597 nonsense probably null
H8562:Intu UTSW 3 40692673 missense probably damaging 1.00
PIT4495001:Intu UTSW 3 40697603 missense probably benign 0.07
R0010:Intu UTSW 3 40654272 intron probably benign
R0173:Intu UTSW 3 40675346 critical splice donor site probably null
R0426:Intu UTSW 3 40675305 missense probably damaging 0.97
R1566:Intu UTSW 3 40692578 missense probably damaging 0.99
R1619:Intu UTSW 3 40697631 nonsense probably null
R1658:Intu UTSW 3 40692781 missense probably benign 0.20
R1701:Intu UTSW 3 40664264 missense probably damaging 1.00
R1707:Intu UTSW 3 40540924 missense probably benign 0.03
R1707:Intu UTSW 3 40683501 missense possibly damaging 0.69
R1867:Intu UTSW 3 40664335 missense probably damaging 1.00
R1868:Intu UTSW 3 40664335 missense probably damaging 1.00
R2090:Intu UTSW 3 40683536 missense probably benign 0.00
R2310:Intu UTSW 3 40653813 missense probably benign
R2989:Intu UTSW 3 40692710 missense probably benign 0.11
R4168:Intu UTSW 3 40672623 missense probably benign 0.00
R4530:Intu UTSW 3 40683364 missense possibly damaging 0.95
R5093:Intu UTSW 3 40692917 missense probably benign 0.00
R5541:Intu UTSW 3 40692587 unclassified probably null
R5587:Intu UTSW 3 40675308 missense probably damaging 0.99
R5745:Intu UTSW 3 40692972 splice site probably null
R5809:Intu UTSW 3 40679590 missense probably damaging 0.99
R5939:Intu UTSW 3 40692584 missense probably damaging 1.00
R5953:Intu UTSW 3 40679550 missense probably damaging 1.00
R6063:Intu UTSW 3 40654094 missense probably damaging 0.97
R6245:Intu UTSW 3 40675326 missense probably damaging 0.98
R6310:Intu UTSW 3 40701291 nonsense probably null
R6353:Intu UTSW 3 40653708 missense probably damaging 1.00
R6451:Intu UTSW 3 40701293 missense possibly damaging 0.94
R6660:Intu UTSW 3 40531951 missense probably benign 0.00
R6848:Intu UTSW 3 40694255 missense probably benign 0.00
R7440:Intu UTSW 3 40697551 missense probably benign 0.04
R7625:Intu UTSW 3 40697599 missense probably benign
R7633:Intu UTSW 3 40654253 missense probably damaging 1.00
R7798:Intu UTSW 3 40691929 missense probably damaging 1.00
R7877:Intu UTSW 3 40699792 missense probably benign 0.07
R7978:Intu UTSW 3 40697639 missense probably damaging 1.00
R8319:Intu UTSW 3 40653772 missense probably damaging 1.00
R8332:Intu UTSW 3 40675289 missense probably benign 0.35
Z1177:Intu UTSW 3 40697516 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GCCCGTGTCCATTCTGAAAC -3'
(R):5'- TTCTAAGACCAGGGCATGTGG -3'

Sequencing Primer
(F):5'- CGTGTCCATTCTGAAACATCAG -3'
(R):5'- ACTTGGAGCCTGAAACTTCTG -3'
Posted On2017-06-26