Incidental Mutation 'R6000:Ephb2'
ID480767
Institutional Source Beutler Lab
Gene Symbol Ephb2
Ensembl Gene ENSMUSG00000028664
Gene NameEph receptor B2
SynonymsErk, eteck, Tyro5, Prkm5, Drt, Hek5, Sek3, Qek5, Cek5, Nuk
MMRRC Submission 044179-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.824) question?
Stock #R6000 (G1)
Quality Score185.009
Status Validated
Chromosome4
Chromosomal Location136647539-136835988 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 136684030 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 440 (S440T)
Ref Sequence ENSEMBL: ENSMUSP00000101472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059287] [ENSMUST00000105845] [ENSMUST00000105846]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059287
AA Change: S440T

PolyPhen 2 Score 0.761 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000058135
Gene: ENSMUSG00000028664
AA Change: S440T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EPH_lbd 20 197 7.37e-130 SMART
Pfam:GCC2_GCC3 261 304 8.1e-10 PFAM
FN3 325 417 1.75e-6 SMART
FN3 436 518 1.23e-10 SMART
Pfam:EphA2_TM 545 619 6e-25 PFAM
TyrKc 622 881 1.34e-138 SMART
SAM 911 978 1.18e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105845
AA Change: S440T

PolyPhen 2 Score 0.761 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101471
Gene: ENSMUSG00000028664
AA Change: S440T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EPH_lbd 20 197 7.37e-130 SMART
Pfam:GCC2_GCC3 259 305 2.2e-10 PFAM
FN3 325 417 1.75e-6 SMART
FN3 436 517 1.41e-10 SMART
Pfam:EphA2_TM 543 618 2.1e-30 PFAM
TyrKc 621 880 1.34e-138 SMART
SAM 910 977 1.18e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105846
AA Change: S440T

PolyPhen 2 Score 0.761 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101472
Gene: ENSMUSG00000028664
AA Change: S440T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EPH_lbd 20 197 7.37e-130 SMART
Pfam:GCC2_GCC3 259 305 2.2e-10 PFAM
FN3 325 417 1.75e-6 SMART
FN3 436 517 1.41e-10 SMART
Pfam:EphA2_TM 543 619 1e-30 PFAM
TyrKc 622 881 1.34e-138 SMART
SAM 911 978 1.18e-23 SMART
Predicted Effect unknown
Transcript: ENSMUST00000156558
AA Change: S107T
SMART Domains Protein: ENSMUSP00000116350
Gene: ENSMUSG00000028664
AA Change: S107T

DomainStartEndE-ValueType
FN3 1 85 6.48e1 SMART
FN3 104 186 1.23e-10 SMART
Pfam:EphA2_TM 213 276 2.5e-16 PFAM
Meta Mutation Damage Score 0.0596 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: This gene encodes a member of the Eph receptor family of receptor tyrosine kinase transmembrane glycoproteins. These receptors consist of an N-terminal glycosylated ligand-binding domain, a transmembrane region and an intracellular kinase domain. The encoded receptor preferentially binds membrane-bound ephrin-B ligands and is involved in nervous system and vascular development. This gene is used as a marker of intestinal stem cells. Homozygous knockout mice for this gene exhibit impaired axon guidance and vestibular function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal axon guidance, circling, head bobbing, and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik T C 16: 88,759,539 C214R possibly damaging Het
5430403G16Rik A G 5: 109,676,864 V240A probably benign Het
Ahnak A T 19: 9,013,111 K3920* probably null Het
Alox12b A G 11: 69,169,568 D650G probably damaging Het
Amt A T 9: 108,301,485 Y400F probably benign Het
Ankrd11 A G 8: 122,891,195 S1973P possibly damaging Het
Aoc1 A T 6: 48,907,639 T539S probably benign Het
Arhgap44 CTGCT CTGCTTGCT 11: 65,032,084 probably null Het
Ccdc15 C T 9: 37,315,764 G292S probably benign Het
Ccdc162 C T 10: 41,561,163 C287Y possibly damaging Het
Cdk15 G A 1: 59,289,659 G244D probably damaging Het
Cep290 T A 10: 100,541,787 Y1560N probably damaging Het
Cic A C 7: 25,271,998 I385L probably benign Het
Cobl A T 11: 12,369,684 F231L probably benign Het
Cpeb1 T C 7: 81,361,680 D171G possibly damaging Het
Csnk1g2 T A 10: 80,638,944 V305E probably damaging Het
Cyp2c29 A G 19: 39,307,606 probably null Het
Dner A T 1: 84,383,929 M653K possibly damaging Het
Dst T A 1: 34,212,223 M4311K possibly damaging Het
Ep400 A G 5: 110,683,201 S2200P unknown Het
Ercc1 A T 7: 19,347,161 probably benign Het
Folh1 T A 7: 86,725,934 N615Y probably benign Het
Gm35911 G T 5: 99,941,367 A164S probably benign Het
Gm7298 T C 6: 121,765,079 Y487H possibly damaging Het
Gucy1b2 A T 14: 62,419,050 I286N probably benign Het
Hr A G 14: 70,567,833 D1005G probably damaging Het
Ifrd1 C A 12: 40,216,244 V117F possibly damaging Het
Ift140 A T 17: 25,036,960 T210S probably benign Het
Igll1 C A 16: 16,863,941 probably benign Het
Ino80 G T 2: 119,374,508 S1512R probably benign Het
Intu A T 3: 40,654,148 K197* probably null Het
Kdm6b A G 11: 69,403,598 L1216P unknown Het
Klrb1c T G 6: 128,784,157 D169A probably damaging Het
Lamp3 T A 16: 19,700,948 T162S possibly damaging Het
Mapk10 G A 5: 102,966,475 P319L probably damaging Het
Mapk10 G A 5: 102,966,476 P319S probably damaging Het
Mical3 T C 6: 121,021,320 T702A probably benign Het
Mstn C T 1: 53,061,669 probably benign Het
Nckap1l T C 15: 103,478,815 S706P probably benign Het
Nckap5l G A 15: 99,426,885 T579I probably damaging Het
Olfr1197 C A 2: 88,729,231 A123S probably damaging Het
Olfr1341 A T 4: 118,710,244 N279I probably damaging Het
Olfr285 G A 15: 98,313,436 T38I probably benign Het
Pcdh18 A C 3: 49,754,464 S801A probably damaging Het
Pde11a A T 2: 76,017,860 D874E probably damaging Het
Pfdn6 G T 17: 33,939,615 P62T probably damaging Het
Pkd1l1 A G 11: 8,950,427 I38T probably benign Het
Prkdc A T 16: 15,829,697 I3662F possibly damaging Het
Psg26 A T 7: 18,482,692 L74* probably null Het
Rassf6 A G 5: 90,603,877 V341A probably damaging Het
Rsad2 C A 12: 26,447,151 probably null Het
Rwdd3 A G 3: 121,156,513 Y95H probably damaging Het
Scfd1 A G 12: 51,445,674 I589V possibly damaging Het
Sgsm1 A T 5: 113,286,838 I131N probably damaging Het
Tecpr1 A G 5: 144,211,421 S389P probably benign Het
Tle3 T A 9: 61,374,014 I29N probably damaging Het
Tmem63c C A 12: 87,057,197 N73K probably damaging Het
Tpm2 T A 4: 43,518,301 probably null Het
Trak2 A T 1: 58,911,812 D405E possibly damaging Het
Ttn C A 2: 76,745,172 A23380S probably damaging Het
Ttn A T 2: 76,885,151 probably benign Het
Tub T C 7: 109,029,650 S391P probably damaging Het
Ush2a G T 1: 188,267,026 E178* probably null Het
Wdr66 A G 5: 123,254,372 probably benign Het
Wisp3 T C 10: 39,158,300 Y102C probably damaging Het
Ylpm1 C A 12: 84,997,256 T256K unknown Het
Other mutations in Ephb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Ephb2 APN 4 136657484 missense probably damaging 0.96
IGL00963:Ephb2 APN 4 136658951 missense probably benign 0.04
IGL01111:Ephb2 APN 4 136657410 missense probably benign 0.01
IGL01462:Ephb2 APN 4 136771370 missense possibly damaging 0.61
IGL01863:Ephb2 APN 4 136659777 missense probably benign 0.03
IGL02149:Ephb2 APN 4 136693914 missense probably damaging 1.00
IGL02232:Ephb2 APN 4 136657451 missense probably damaging 0.97
IGL02269:Ephb2 APN 4 136771049 missense possibly damaging 0.66
IGL02828:Ephb2 APN 4 136771150 missense probably benign 0.09
IGL03109:Ephb2 APN 4 136771544 missense probably damaging 1.00
IGL03284:Ephb2 APN 4 136661516 missense probably damaging 0.96
PIT4453001:Ephb2 UTSW 4 136660810 missense probably benign 0.00
R0004:Ephb2 UTSW 4 136657524 missense probably damaging 1.00
R0121:Ephb2 UTSW 4 136771057 missense probably damaging 0.99
R0539:Ephb2 UTSW 4 136655976 missense probably damaging 1.00
R0614:Ephb2 UTSW 4 136673365 missense probably benign 0.00
R0988:Ephb2 UTSW 4 136659708 missense possibly damaging 0.59
R1471:Ephb2 UTSW 4 136658951 missense probably benign 0.04
R1473:Ephb2 UTSW 4 136694058 missense possibly damaging 0.83
R1546:Ephb2 UTSW 4 136771009 missense probably damaging 0.99
R1639:Ephb2 UTSW 4 136693905 missense probably benign 0.10
R1725:Ephb2 UTSW 4 136659778 nonsense probably null
R1779:Ephb2 UTSW 4 136693825 missense possibly damaging 0.64
R1818:Ephb2 UTSW 4 136655336 missense probably benign 0.02
R2099:Ephb2 UTSW 4 136660755 missense probably damaging 1.00
R2916:Ephb2 UTSW 4 136683945 missense probably damaging 0.99
R3885:Ephb2 UTSW 4 136771034 missense probably damaging 1.00
R4572:Ephb2 UTSW 4 136655940 missense probably damaging 1.00
R4709:Ephb2 UTSW 4 136696052 missense probably damaging 1.00
R4893:Ephb2 UTSW 4 136659753 missense probably damaging 0.99
R4981:Ephb2 UTSW 4 136696010 missense probably benign 0.09
R4992:Ephb2 UTSW 4 136660839 missense probably damaging 1.00
R5004:Ephb2 UTSW 4 136659699 missense possibly damaging 0.77
R5307:Ephb2 UTSW 4 136693787 missense possibly damaging 0.89
R5370:Ephb2 UTSW 4 136771570 missense probably benign 0.00
R5561:Ephb2 UTSW 4 136661406 missense probably damaging 1.00
R5643:Ephb2 UTSW 4 136771612 missense probably damaging 0.99
R5826:Ephb2 UTSW 4 136660737 missense probably damaging 1.00
R5858:Ephb2 UTSW 4 136672445 missense probably benign
R5867:Ephb2 UTSW 4 136675422 missense possibly damaging 0.81
R5990:Ephb2 UTSW 4 136696055 missense probably benign 0.03
R6156:Ephb2 UTSW 4 136661505 missense probably benign 0.44
R6413:Ephb2 UTSW 4 136771122 missense probably benign 0.08
R6577:Ephb2 UTSW 4 136657550 missense probably damaging 0.99
R6633:Ephb2 UTSW 4 136683996 missense probably benign 0.07
R6720:Ephb2 UTSW 4 136657502 missense probably damaging 0.99
R6795:Ephb2 UTSW 4 136673335 missense possibly damaging 0.88
R7235:Ephb2 UTSW 4 136693828 missense probably damaging 1.00
R7260:Ephb2 UTSW 4 136771574 missense probably damaging 0.96
R7328:Ephb2 UTSW 4 136658934 critical splice donor site probably null
R7404:Ephb2 UTSW 4 136771213 missense probably damaging 1.00
R7466:Ephb2 UTSW 4 136659065 missense probably damaging 1.00
R7524:Ephb2 UTSW 4 136659709 missense probably damaging 1.00
R7605:Ephb2 UTSW 4 136771108 missense probably damaging 1.00
R7611:Ephb2 UTSW 4 136660901 critical splice acceptor site probably null
R7777:Ephb2 UTSW 4 136771636 missense possibly damaging 0.92
R7889:Ephb2 UTSW 4 136771042 missense probably damaging 0.99
R7972:Ephb2 UTSW 4 136771042 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAGTACACACCAGGCCTAG -3'
(R):5'- TGTACCTCATCTAGTTCCACAACAC -3'

Sequencing Primer
(F):5'- CCTAGACTGGGAGAGGGGC -3'
(R):5'- TGTCACAAGCCCCCTAGAG -3'
Posted On2017-06-26