Incidental Mutation 'R6000:Hr'
ID480804
Institutional Source Beutler Lab
Gene Symbol Hr
Ensembl Gene ENSMUSG00000022096
Gene Namehairless
SynonymsALUNC, AU, N, ba, bldy, hr, rh, rh-bmh, rhino
MMRRC Submission 044179-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6000 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location70552212-70573548 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70567833 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1005 (D1005G)
Ref Sequence ENSEMBL: ENSMUSP00000124816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022691] [ENSMUST00000161069] [ENSMUST00000163060]
Predicted Effect probably damaging
Transcript: ENSMUST00000022691
AA Change: D1005G

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022691
Gene: ENSMUSG00000022096
AA Change: D1005G

DomainStartEndE-ValueType
Blast:JmjC 54 849 N/A BLAST
JmjC 939 1150 5.23e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161069
AA Change: D1005G

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124816
Gene: ENSMUSG00000022096
AA Change: D1005G

DomainStartEndE-ValueType
Blast:JmjC 54 849 N/A BLAST
JmjC 939 1150 5.23e-38 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000163060
AA Change: D1034G

PolyPhen 2 Score 0.570 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124042
Gene: ENSMUSG00000022096
AA Change: D1034G

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Blast:JmjC 83 878 N/A BLAST
JmjC 968 1179 5.23e-38 SMART
Meta Mutation Damage Score 0.8539 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: This gene encodes a protein that is involved in hair growth. This protein functions as a transcriptional corepressor of multiple nuclear receptors, including thyroid hormone receptor, the retinoic acid receptor-related orphan receptors and the vitamin D receptors, and it interacts with histone deacetylases. The translation of this protein is modulated by a regulatory ORF that exists upstream of the primary ORF. Mutations in this upstream ORF, U2HR, cause Marie Unna hereditary hypotrichosis (MUHH), an autosomal dominant form of genetic hair loss in human. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mutant homozygotes exhibit hair loss, usually wrinkled skin with epidermal cysts. Females do not nurse their pups well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik T C 16: 88,759,539 C214R possibly damaging Het
5430403G16Rik A G 5: 109,676,864 V240A probably benign Het
Ahnak A T 19: 9,013,111 K3920* probably null Het
Alox12b A G 11: 69,169,568 D650G probably damaging Het
Amt A T 9: 108,301,485 Y400F probably benign Het
Ankrd11 A G 8: 122,891,195 S1973P possibly damaging Het
Aoc1 A T 6: 48,907,639 T539S probably benign Het
Arhgap44 CTGCT CTGCTTGCT 11: 65,032,084 probably null Het
Ccdc15 C T 9: 37,315,764 G292S probably benign Het
Ccdc162 C T 10: 41,561,163 C287Y possibly damaging Het
Cdk15 G A 1: 59,289,659 G244D probably damaging Het
Cep290 T A 10: 100,541,787 Y1560N probably damaging Het
Cic A C 7: 25,271,998 I385L probably benign Het
Cobl A T 11: 12,369,684 F231L probably benign Het
Cpeb1 T C 7: 81,361,680 D171G possibly damaging Het
Csnk1g2 T A 10: 80,638,944 V305E probably damaging Het
Cyp2c29 A G 19: 39,307,606 probably null Het
Dner A T 1: 84,383,929 M653K possibly damaging Het
Dst T A 1: 34,212,223 M4311K possibly damaging Het
Ep400 A G 5: 110,683,201 S2200P unknown Het
Ephb2 A T 4: 136,684,030 S440T possibly damaging Het
Ercc1 A T 7: 19,347,161 probably benign Het
Folh1 T A 7: 86,725,934 N615Y probably benign Het
Gm35911 G T 5: 99,941,367 A164S probably benign Het
Gm7298 T C 6: 121,765,079 Y487H possibly damaging Het
Gucy1b2 A T 14: 62,419,050 I286N probably benign Het
Ifrd1 C A 12: 40,216,244 V117F possibly damaging Het
Ift140 A T 17: 25,036,960 T210S probably benign Het
Igll1 C A 16: 16,863,941 probably benign Het
Ino80 G T 2: 119,374,508 S1512R probably benign Het
Intu A T 3: 40,654,148 K197* probably null Het
Kdm6b A G 11: 69,403,598 L1216P unknown Het
Klrb1c T G 6: 128,784,157 D169A probably damaging Het
Lamp3 T A 16: 19,700,948 T162S possibly damaging Het
Mapk10 G A 5: 102,966,475 P319L probably damaging Het
Mapk10 G A 5: 102,966,476 P319S probably damaging Het
Mical3 T C 6: 121,021,320 T702A probably benign Het
Mstn C T 1: 53,061,669 probably benign Het
Nckap1l T C 15: 103,478,815 S706P probably benign Het
Nckap5l G A 15: 99,426,885 T579I probably damaging Het
Olfr1197 C A 2: 88,729,231 A123S probably damaging Het
Olfr1341 A T 4: 118,710,244 N279I probably damaging Het
Olfr285 G A 15: 98,313,436 T38I probably benign Het
Pcdh18 A C 3: 49,754,464 S801A probably damaging Het
Pde11a A T 2: 76,017,860 D874E probably damaging Het
Pfdn6 G T 17: 33,939,615 P62T probably damaging Het
Pkd1l1 A G 11: 8,950,427 I38T probably benign Het
Prkdc A T 16: 15,829,697 I3662F possibly damaging Het
Psg26 A T 7: 18,482,692 L74* probably null Het
Rassf6 A G 5: 90,603,877 V341A probably damaging Het
Rsad2 C A 12: 26,447,151 probably null Het
Rwdd3 A G 3: 121,156,513 Y95H probably damaging Het
Scfd1 A G 12: 51,445,674 I589V possibly damaging Het
Sgsm1 A T 5: 113,286,838 I131N probably damaging Het
Tecpr1 A G 5: 144,211,421 S389P probably benign Het
Tle3 T A 9: 61,374,014 I29N probably damaging Het
Tmem63c C A 12: 87,057,197 N73K probably damaging Het
Tpm2 T A 4: 43,518,301 probably null Het
Trak2 A T 1: 58,911,812 D405E possibly damaging Het
Ttn C A 2: 76,745,172 A23380S probably damaging Het
Ttn A T 2: 76,885,151 probably benign Het
Tub T C 7: 109,029,650 S391P probably damaging Het
Ush2a G T 1: 188,267,026 E178* probably null Het
Wdr66 A G 5: 123,254,372 probably benign Het
Wisp3 T C 10: 39,158,300 Y102C probably damaging Het
Ylpm1 C A 12: 84,997,256 T256K unknown Het
Other mutations in Hr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01805:Hr APN 14 70565297 splice site probably benign
IGL02020:Hr APN 14 70556437 missense probably benign 0.01
IGL02372:Hr APN 14 70558350 missense possibly damaging 0.94
IGL02380:Hr APN 14 70557761 missense probably damaging 0.98
IGL02554:Hr APN 14 70559866 splice site probably benign
IGL02949:Hr APN 14 70559785 missense possibly damaging 0.87
IGL03406:Hr APN 14 70563420 critical splice donor site probably null
angie UTSW 14 70567833 missense probably damaging 0.97
blofeld UTSW 14 70568085 missense probably damaging 1.00
general UTSW 14 70563684 critical splice donor site probably null
kaburo UTSW 14 unclassified
mister_clean UTSW 14 70560065 critical splice donor site probably benign
mushroom UTSW 14 70568085 missense probably damaging 1.00
prune UTSW 14 70571429 missense probably damaging 1.00
ren UTSW 14 70568085 missense probably damaging 1.00
subclinical UTSW 14 70561836 missense possibly damaging 0.89
yuanxiao UTSW 14 70571448 missense probably damaging 1.00
R0018:Hr UTSW 14 70558277 missense probably benign
R0038:Hr UTSW 14 70568085 missense probably damaging 1.00
R0374:Hr UTSW 14 70556476 missense probably benign 0.01
R0511:Hr UTSW 14 70561912 nonsense probably null
R0609:Hr UTSW 14 70559657 missense probably benign
R1828:Hr UTSW 14 70572037 critical splice donor site probably null
R2030:Hr UTSW 14 70571448 missense probably damaging 1.00
R2266:Hr UTSW 14 70558107 missense probably benign
R2267:Hr UTSW 14 70558107 missense probably benign
R2268:Hr UTSW 14 70558107 missense probably benign
R2377:Hr UTSW 14 70557878 missense probably damaging 1.00
R3686:Hr UTSW 14 70557796 missense probably damaging 0.98
R3687:Hr UTSW 14 70557796 missense probably damaging 0.98
R3754:Hr UTSW 14 70567824 missense probably damaging 1.00
R3803:Hr UTSW 14 70557893 missense probably benign 0.01
R3846:Hr UTSW 14 70571453 missense probably damaging 1.00
R3977:Hr UTSW 14 70563584 missense probably benign 0.01
R3978:Hr UTSW 14 70563584 missense probably benign 0.01
R3979:Hr UTSW 14 70563584 missense probably benign 0.01
R4528:Hr UTSW 14 70566383 missense probably damaging 1.00
R4654:Hr UTSW 14 70563573 missense probably damaging 0.99
R4834:Hr UTSW 14 70559922 missense probably damaging 0.98
R4847:Hr UTSW 14 70556476 missense probably benign 0.04
R4863:Hr UTSW 14 70571972 missense probably damaging 1.00
R5292:Hr UTSW 14 70571992 missense probably damaging 1.00
R5452:Hr UTSW 14 70556627 missense probably damaging 1.00
R5717:Hr UTSW 14 70566176 missense probably benign 0.34
R5902:Hr UTSW 14 70557791 missense probably benign 0.02
R6439:Hr UTSW 14 70561836 missense possibly damaging 0.89
R6823:Hr UTSW 14 70565374 missense probably damaging 0.98
R7030:Hr UTSW 14 70563684 critical splice donor site probably null
R7213:Hr UTSW 14 70558350 missense probably damaging 0.99
R7452:Hr UTSW 14 70571486 missense probably damaging 1.00
R7468:Hr UTSW 14 70558212 missense possibly damaging 0.89
R7572:Hr UTSW 14 70561853 missense possibly damaging 0.66
R7996:Hr UTSW 14 70563603 nonsense probably null
R7997:Hr UTSW 14 70563603 nonsense probably null
X0025:Hr UTSW 14 70566951 splice site probably null
X0026:Hr UTSW 14 70567841 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTATGGTGAGTGCCTTTCCAC -3'
(R):5'- GGAACACATGCCACACAGTG -3'

Sequencing Primer
(F):5'- TGTCCACCCCACACCTCTG -3'
(R):5'- ATGCCACACAGTGCTGGTC -3'
Posted On2017-06-26