Mutagenetix > Incidental Mutations

Incidental Mutation 'R6000:Ift140'

480812

Institutional Source

Beutler Lab

Gene Symbol

Ift140

Ensembl Gene

ENSMUSG00000024169

Gene Name

intraflagellar transport 140

Synonyms

Tce5, Wdtc2

MMRRC Submission

044179-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6000 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

25016091-25099495 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 25036960 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 210 (T210S)

Ref Sequence

ENSEMBL: ENSMUSP00000116689 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000137386] [ENSMUST00000156945]

Predicted Effect

probably benign
Transcript: ENSMUST00000024983
AA Change: T479S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169
AA Change: T479S

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	8e-17	BLAST
Blast:WD40	510	547	6e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	9e-13	BLAST
Blast:TPR	1011	1044	1e-13	BLAST
Blast:TPR	1377	1410	8e-13	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000137386
AA Change: T479S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169
AA Change: T479S

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	1e-16	BLAST
Blast:WD40	510	547	5e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	8e-13	BLAST
Blast:TPR	1011	1044	9e-14	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142000

Predicted Effect

probably benign
Transcript: ENSMUST00000156945
AA Change: T210S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000116689
Gene: ENSMUSG00000024169
AA Change: T210S

Domain	Start	End	E-Value	Type
Blast:WD40	2	35	6e-12	BLAST
SCOP:d1erja_	19	131	5e-7	SMART
Blast:WD40	39	83	1e-24	BLAST
Blast:WD40	95	136	2e-18	BLAST

Meta Mutation Damage Score

0.1104

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 91.7%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the intraflagellar transport (IFT) complex A. Intraflagellar transport is involved in the genesis, resorption and signaling of primary cilia. The primary cilium is a microtubule-based sensory organelle at the surface of most quiescent mammalian cells, that receives signals from its environment, such as the flow of fluid, light or odors, and transduces those signals to the nucleus. Loss of the corresponding protein in mouse results in renal cystic disease. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a reporter knock-out allele die at mid-gestation. Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects and situs abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310034C09Rik	T	C	16: 88,759,539	C214R	possibly damaging	Het
5430403G16Rik	A	G	5: 109,676,864	V240A	probably benign	Het
Ahnak	A	T	19: 9,013,111	K3920*	probably null	Het
Alox12b	A	G	11: 69,169,568	D650G	probably damaging	Het
Amt	A	T	9: 108,301,485	Y400F	probably benign	Het
Ankrd11	A	G	8: 122,891,195	S1973P	possibly damaging	Het
Aoc1	A	T	6: 48,907,639	T539S	probably benign	Het
Arhgap44	CTGCT	CTGCTTGCT	11: 65,032,084		probably null	Het
Ccdc15	C	T	9: 37,315,764	G292S	probably benign	Het
Ccdc162	C	T	10: 41,561,163	C287Y	possibly damaging	Het
Cdk15	G	A	1: 59,289,659	G244D	probably damaging	Het
Cep290	T	A	10: 100,541,787	Y1560N	probably damaging	Het
Cic	A	C	7: 25,271,998	I385L	probably benign	Het
Cobl	A	T	11: 12,369,684	F231L	probably benign	Het
Cpeb1	T	C	7: 81,361,680	D171G	possibly damaging	Het
Csnk1g2	T	A	10: 80,638,944	V305E	probably damaging	Het
Cyp2c29	A	G	19: 39,307,606		probably null	Het
Dner	A	T	1: 84,383,929	M653K	possibly damaging	Het
Dst	T	A	1: 34,212,223	M4311K	possibly damaging	Het
Ep400	A	G	5: 110,683,201	S2200P	unknown	Het
Ephb2	A	T	4: 136,684,030	S440T	possibly damaging	Het
Ercc1	A	T	7: 19,347,161		probably benign	Het
Folh1	T	A	7: 86,725,934	N615Y	probably benign	Het
Gm35911	G	T	5: 99,941,367	A164S	probably benign	Het
Gm7298	T	C	6: 121,765,079	Y487H	possibly damaging	Het
Gucy1b2	A	T	14: 62,419,050	I286N	probably benign	Het
Hr	A	G	14: 70,567,833	D1005G	probably damaging	Het
Ifrd1	C	A	12: 40,216,244	V117F	possibly damaging	Het
Igll1	C	A	16: 16,863,941		probably benign	Het
Ino80	G	T	2: 119,374,508	S1512R	probably benign	Het
Intu	A	T	3: 40,654,148	K197*	probably null	Het
Kdm6b	A	G	11: 69,403,598	L1216P	unknown	Het
Klrb1c	T	G	6: 128,784,157	D169A	probably damaging	Het
Lamp3	T	A	16: 19,700,948	T162S	possibly damaging	Het
Mapk10	G	A	5: 102,966,475	P319L	probably damaging	Het
Mapk10	G	A	5: 102,966,476	P319S	probably damaging	Het
Mical3	T	C	6: 121,021,320	T702A	probably benign	Het
Mstn	C	T	1: 53,061,669		probably benign	Het
Nckap1l	T	C	15: 103,478,815	S706P	probably benign	Het
Nckap5l	G	A	15: 99,426,885	T579I	probably damaging	Het
Olfr1197	C	A	2: 88,729,231	A123S	probably damaging	Het
Olfr1341	A	T	4: 118,710,244	N279I	probably damaging	Het
Olfr285	G	A	15: 98,313,436	T38I	probably benign	Het
Pcdh18	A	C	3: 49,754,464	S801A	probably damaging	Het
Pde11a	A	T	2: 76,017,860	D874E	probably damaging	Het
Pfdn6	G	T	17: 33,939,615	P62T	probably damaging	Het
Pkd1l1	A	G	11: 8,950,427	I38T	probably benign	Het
Prkdc	A	T	16: 15,829,697	I3662F	possibly damaging	Het
Psg26	A	T	7: 18,482,692	L74*	probably null	Het
Rassf6	A	G	5: 90,603,877	V341A	probably damaging	Het
Rsad2	C	A	12: 26,447,151		probably null	Het
Rwdd3	A	G	3: 121,156,513	Y95H	probably damaging	Het
Scfd1	A	G	12: 51,445,674	I589V	possibly damaging	Het
Sgsm1	A	T	5: 113,286,838	I131N	probably damaging	Het
Tecpr1	A	G	5: 144,211,421	S389P	probably benign	Het
Tle3	T	A	9: 61,374,014	I29N	probably damaging	Het
Tmem63c	C	A	12: 87,057,197	N73K	probably damaging	Het
Tpm2	T	A	4: 43,518,301		probably null	Het
Trak2	A	T	1: 58,911,812	D405E	possibly damaging	Het
Ttn	C	A	2: 76,745,172	A23380S	probably damaging	Het
Ttn	A	T	2: 76,885,151		probably benign	Het
Tub	T	C	7: 109,029,650	S391P	probably damaging	Het
Ush2a	G	T	1: 188,267,026	E178*	probably null	Het
Wdr66	A	G	5: 123,254,372		probably benign	Het
Wisp3	T	C	10: 39,158,300	Y102C	probably damaging	Het
Ylpm1	C	A	12: 84,997,256	T256K	unknown	Het

Other mutations in Ift140

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00753:Ift140	APN	17	25055644	missense	probably damaging	1.00
IGL00966:Ift140	APN	17	25018802	missense	probably damaging	1.00
IGL01082:Ift140	APN	17	25048455	missense	possibly damaging	0.89
IGL01394:Ift140	APN	17	25094702	missense	probably benign	0.02
IGL01816:Ift140	APN	17	25087025	splice site	probably null
IGL01994:Ift140	APN	17	25048443	missense	probably damaging	1.00
IGL02102:Ift140	APN	17	25033130	missense	probably benign	0.03
IGL02207:Ift140	APN	17	25055598	missense	probably benign
IGL02493:Ift140	APN	17	25087924	nonsense	probably null
IGL02735:Ift140	APN	17	25034035	splice site	probably benign
IGL02902:Ift140	APN	17	25090762	missense	probably damaging	1.00
IGL03037:Ift140	APN	17	25092394	missense	probably benign	0.02
IGL03122:Ift140	APN	17	25086910	missense	probably damaging	1.00
IGL03206:Ift140	APN	17	25092826	missense	probably damaging	0.98
IGL03271:Ift140	APN	17	25087906	missense	probably damaging	1.00
IGL03358:Ift140	APN	17	25087984	missense	probably damaging	1.00
PIT4515001:Ift140	UTSW	17	25086860	missense	probably damaging	0.98
R0100:Ift140	UTSW	17	25090954	nonsense	probably null
R0100:Ift140	UTSW	17	25090954	nonsense	probably null
R0197:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0238:Ift140	UTSW	17	25045523	nonsense	probably null
R0238:Ift140	UTSW	17	25045523	nonsense	probably null
R0239:Ift140	UTSW	17	25045523	nonsense	probably null
R0239:Ift140	UTSW	17	25045523	nonsense	probably null
R0355:Ift140	UTSW	17	25048435	nonsense	probably null
R0399:Ift140	UTSW	17	25050340	missense	possibly damaging	0.77
R0574:Ift140	UTSW	17	25051760	splice site	probably null
R0610:Ift140	UTSW	17	25035803	missense	probably benign	0.06
R0701:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0883:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0900:Ift140	UTSW	17	25035812	missense	probably benign	0.22
R1167:Ift140	UTSW	17	25035745	missense	probably benign	0.01
R1295:Ift140	UTSW	17	25088933	critical splice donor site	probably null
R1588:Ift140	UTSW	17	25087985	missense	probably damaging	1.00
R1619:Ift140	UTSW	17	25088865	missense	probably damaging	1.00
R1637:Ift140	UTSW	17	25025634	missense	probably benign	0.40
R1854:Ift140	UTSW	17	25035839	missense	probably benign	0.05
R2397:Ift140	UTSW	17	25020736	missense	probably damaging	1.00
R2510:Ift140	UTSW	17	25036308	missense	probably benign	0.02
R2918:Ift140	UTSW	17	25035831	missense	possibly damaging	0.66
R3433:Ift140	UTSW	17	25036308	missense	probably benign	0.02
R3878:Ift140	UTSW	17	25028944	missense	probably benign	0.25
R4559:Ift140	UTSW	17	25090767	missense	probably damaging	0.97
R4670:Ift140	UTSW	17	25098961	unclassified	probably benign
R4711:Ift140	UTSW	17	25094717	splice site	probably null
R4934:Ift140	UTSW	17	25048488	missense	probably benign
R4949:Ift140	UTSW	17	25094665	missense	probably benign	0.06
R4982:Ift140	UTSW	17	25036994	missense	probably damaging	0.99
R5099:Ift140	UTSW	17	25090700	missense	probably damaging	1.00
R5223:Ift140	UTSW	17	25035812	missense	probably benign	0.22
R5268:Ift140	UTSW	17	25020627	missense	possibly damaging	0.48
R5423:Ift140	UTSW	17	25033085	missense	probably damaging	0.96
R5480:Ift140	UTSW	17	25020576	missense	probably damaging	1.00
R5655:Ift140	UTSW	17	25045064	missense	probably damaging	1.00
R5756:Ift140	UTSW	17	25028813	missense	possibly damaging	0.62
R5837:Ift140	UTSW	17	25089540	missense	probably damaging	1.00
R5894:Ift140	UTSW	17	25033919	missense	possibly damaging	0.92
R5907:Ift140	UTSW	17	25092371	missense	probably benign	0.02
R5966:Ift140	UTSW	17	25094761	nonsense	probably null
R6046:Ift140	UTSW	17	25055589	missense	probably benign	0.00
R6050:Ift140	UTSW	17	25091005	missense	probably damaging	1.00
R6103:Ift140	UTSW	17	25093126	missense	probably damaging	1.00
R6239:Ift140	UTSW	17	25028972	missense	probably benign	0.26
R6287:Ift140	UTSW	17	25050434	missense	probably benign
R6539:Ift140	UTSW	17	25094669	missense	possibly damaging	0.87
R6656:Ift140	UTSW	17	25032173	missense	probably damaging	0.96
R6723:Ift140	UTSW	17	25033116	missense	probably benign	0.08
R6749:Ift140	UTSW	17	25098916	missense	probably damaging	0.99
R6892:Ift140	UTSW	17	25020546	missense	possibly damaging	0.95
R7151:Ift140	UTSW	17	25055725	missense	probably damaging	1.00
R7235:Ift140	UTSW	17	25020645	missense	possibly damaging	0.88
R7424:Ift140	UTSW	17	25037036	missense	possibly damaging	0.81
R7552:Ift140	UTSW	17	25033115	missense	probably benign	0.02
R7560:Ift140	UTSW	17	25092341	missense	probably benign	0.28
R7660:Ift140	UTSW	17	25051824	missense	probably damaging	1.00
R8105:Ift140	UTSW	17	25036975	missense	probably benign	0.01
R8415:Ift140	UTSW	17	25092915	missense	probably damaging	0.99
R8437:Ift140	UTSW	17	25094677	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTGTGTTCTGAGCAGATGTTCC -3'
(R):5'- TTCAGAGGTCACAGCCATAGATG -3'

Sequencing Primer
(F):5'- AGCAGATGTTCCTTTGTGTCTC -3'
(R):5'- AACAGTCACTTACCTGCC -3'

Posted On

2017-06-26