Mutagenetix > Incidental Mutation

Incidental Mutation 'R6001:Pkn3'

480818

Institutional Source

Beutler Lab

Gene Symbol

Pkn3

Ensembl Gene

ENSMUSG00000026785

Gene Name

protein kinase N3

Synonyms

MMRRC Submission

044180-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

30077684-30091022 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 30088584 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000041025 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045246] [ENSMUST00000081838] [ENSMUST00000102865]

AlphaFold

Q8K045

Predicted Effect

probably null
Transcript: ENSMUST00000045246

SMART Domains

Protein: ENSMUSP00000041025
Gene: ENSMUSG00000026785

Domain	Start	End	E-Value	Type
Hr1	15	78	3.45e-17	SMART
Hr1	98	166	6.19e-19	SMART
Hr1	171	239	3.32e-19	SMART
low complexity region	528	537	N/A	INTRINSIC
S_TKc	548	807	2.52e-93	SMART
S_TK_X	808	872	9.58e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000081838

SMART Domains

Protein: ENSMUSP00000080521
Gene: ENSMUSG00000015335

Domain	Start	End	E-Value	Type
transmembrane domain	58	80	N/A	INTRINSIC
low complexity region	89	100	N/A	INTRINSIC
Pfam:zf-DHHC	106	232	1.9e-30	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000102865

SMART Domains

Protein: ENSMUSP00000099929
Gene: ENSMUSG00000015335

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:zf-DHHC	58	218	1.1e-38	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134591

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137001

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137240

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148650

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148717

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156197

Meta Mutation Damage Score

0.9493

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 91.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null mutation are viable, fertile and healthy. Mice with conditional loss of this gene and Pten in hematopoietic cells show a delay in leukemia development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	G	T	4: 53,075,555	R999S	possibly damaging	Het
Ankrd31	T	A	13: 96,826,209	Y503N	probably damaging	Het
Anks4b	A	G	7: 120,182,718	E324G	probably benign	Het
Arhgap44	CTGCT	CTGCTTGCT	11: 65,032,084		probably null	Het
Armc4	T	C	18: 7,286,838	D131G	probably benign	Het
Atl1	A	T	12: 69,932,283	T162S	possibly damaging	Het
Atp2b2	A	G	6: 113,793,767	Y394H	probably damaging	Het
Dennd2d	A	G	3: 106,492,460	H233R	probably benign	Het
Dhx16	G	T	17: 35,883,874	M462I	probably damaging	Het
Hif3a	T	C	7: 17,050,561	Y253C	probably damaging	Het
Hsf4	G	A	8: 105,272,909	G277R	possibly damaging	Het
Impg1	T	C	9: 80,316,172	D754G	probably benign	Het
Keap1	T	C	9: 21,230,839	S580G	possibly damaging	Het
Lrp6	T	C	6: 134,464,518	K1162E	probably benign	Het
Lrrc31	C	T	3: 30,691,169	V110I	possibly damaging	Het
Muc5b	G	T	7: 141,872,381	K4738N	possibly damaging	Het
Myo1a	G	T	10: 127,706,925		probably null	Het
Olfr1491	A	G	19: 13,705,060	T78A	probably damaging	Het
Olfr619	T	A	7: 103,603,972	M106K	probably damaging	Het
Olfr832	A	T	9: 18,945,044	Y132F	probably damaging	Het
Parp4	A	T	14: 56,641,283	H1225L	probably benign	Het
Pcgf2	T	C	11: 97,692,780	Y52C	possibly damaging	Het
Psen2	C	A	1: 180,245,669	R29L	possibly damaging	Het
Rfx6	A	G	10: 51,718,211		probably null	Het
Rps13	T	C	7: 116,331,573	T145A	probably benign	Het
Rsf1	A	ACGGCGACGG	7: 97,579,904		probably null	Het
Rsf1	GCG	GCGACG	7: 97,579,907		probably benign	Het
Rsf1	G	A	7: 97,579,910		probably benign	Het
Smarca4	C	T	9: 21,632,909		probably benign	Het
Stat4	A	T	1: 52,096,867	E445V	probably damaging	Het
Taf13	T	A	3: 108,581,071	I90N	probably damaging	Het
Tas2r124	T	A	6: 132,755,453	Y242N	probably damaging	Het
Tmem151b	T	C	17: 45,545,785	Y243C	probably damaging	Het
Wasl	T	C	6: 24,619,574	T316A	unknown	Het
Zbtb44	T	C	9: 31,053,794	C167R	probably damaging	Het
Zc3h7b	T	C	15: 81,792,035	L714P	possibly damaging	Het
Zfp35	T	A	18: 24,002,759	H53Q	probably benign	Het
Zfp804b	A	G	5: 6,769,043	V1340A	probably benign	Het

Other mutations in Pkn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00422:Pkn3	APN	2	30081104	missense	probably damaging	0.97
IGL00781:Pkn3	APN	2	30083390	unclassified	probably benign
IGL00815:Pkn3	APN	2	30081200	missense	possibly damaging	0.88
IGL01576:Pkn3	APN	2	30087042	missense	probably damaging	1.00
IGL01897:Pkn3	APN	2	30082812	unclassified	probably benign
IGL02513:Pkn3	APN	2	30083137	missense	probably damaging	0.98
IGL02552:Pkn3	APN	2	30080867	missense	probably damaging	1.00
IGL02622:Pkn3	APN	2	30083146	missense	probably benign	0.28
IGL02689:Pkn3	APN	2	30080846	missense	probably damaging	1.00
IGL02996:Pkn3	APN	2	30080615	missense	probably benign	0.39
IGL03106:Pkn3	APN	2	30085245	missense	probably damaging	0.96
Enflamme	UTSW	2	30083037	unclassified	probably benign
Wrath	UTSW	2	30088584	critical splice donor site	probably null
PIT4151001:Pkn3	UTSW	2	30090527	missense	probably damaging	1.00
R0279:Pkn3	UTSW	2	30083297	missense	probably benign	0.16
R0370:Pkn3	UTSW	2	30087172	missense	probably damaging	1.00
R0491:Pkn3	UTSW	2	30089877	missense	probably damaging	1.00
R0600:Pkn3	UTSW	2	30081134	missense	probably benign	0.06
R1418:Pkn3	UTSW	2	30083047	missense	probably damaging	1.00
R1510:Pkn3	UTSW	2	30079764	critical splice donor site	probably null
R1535:Pkn3	UTSW	2	30087053	missense	probably benign
R1540:Pkn3	UTSW	2	30084691	missense	probably damaging	1.00
R1808:Pkn3	UTSW	2	30079651	missense	probably damaging	1.00
R1884:Pkn3	UTSW	2	30082828	missense	probably damaging	1.00
R1995:Pkn3	UTSW	2	30089977	missense	probably damaging	1.00
R3745:Pkn3	UTSW	2	30090341	missense	probably damaging	1.00
R4119:Pkn3	UTSW	2	30083037	unclassified	probably benign
R4258:Pkn3	UTSW	2	30088560	missense	probably damaging	0.99
R4665:Pkn3	UTSW	2	30085457	unclassified	probably benign
R4772:Pkn3	UTSW	2	30084680	splice site	probably null
R4808:Pkn3	UTSW	2	30090081	missense	probably damaging	1.00
R5038:Pkn3	UTSW	2	30085281	critical splice donor site	probably null
R5388:Pkn3	UTSW	2	30081074	missense	probably damaging	0.99
R5488:Pkn3	UTSW	2	30088584	critical splice donor site	probably null
R5611:Pkn3	UTSW	2	30079661	missense	probably damaging	1.00
R6277:Pkn3	UTSW	2	30082945	missense	possibly damaging	0.93
R6562:Pkn3	UTSW	2	30080687	critical splice donor site	probably null
R6724:Pkn3	UTSW	2	30090550	missense	possibly damaging	0.94
R7061:Pkn3	UTSW	2	30083536	splice site	probably null
R7128:Pkn3	UTSW	2	30083315	missense	probably damaging	1.00
R7249:Pkn3	UTSW	2	30084761	missense	probably benign	0.00
R7475:Pkn3	UTSW	2	30087110	missense	probably benign	0.01
R7746:Pkn3	UTSW	2	30090584	missense	probably benign	0.00
R7747:Pkn3	UTSW	2	30090584	missense	probably benign	0.00
R7783:Pkn3	UTSW	2	30079622	missense	probably damaging	1.00
R8401:Pkn3	UTSW	2	30080059	missense	probably benign	0.00
R8425:Pkn3	UTSW	2	30086501	critical splice donor site	probably null
R8535:Pkn3	UTSW	2	30079924	critical splice acceptor site	probably null
R8720:Pkn3	UTSW	2	30085184	missense	probably benign	0.01
R8743:Pkn3	UTSW	2	30083306	missense	probably benign	0.00
R9415:Pkn3	UTSW	2	30078320	missense	probably benign	0.20
R9437:Pkn3	UTSW	2	30083255	missense	possibly damaging	0.93
R9583:Pkn3	UTSW	2	30086711	missense	probably null	0.99
R9800:Pkn3	UTSW	2	30083278	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CCATAGCTGAGCACAGGAAG -3'
(R):5'- CAAAGTCTGCAATCTTGAGGAAACC -3'

Sequencing Primer
(F):5'- CAAGACTGGAATATTTTGGGCTTCTC -3'
(R):5'- ATCTTGAGGAAACCCTGGGCATC -3'

Posted On

2017-06-26