Incidental Mutation 'R6001:Hsf4'
ID480836
Institutional Source Beutler Lab
Gene Symbol Hsf4
Ensembl Gene ENSMUSG00000033249
Gene Nameheat shock transcription factor 4
Synonymsldis1
MMRRC Submission 044180-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6001 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location105269801-105275845 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 105272909 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 277 (G277R)
Ref Sequence ENSEMBL: ENSMUSP00000134206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014920] [ENSMUST00000036127] [ENSMUST00000036221] [ENSMUST00000126923] [ENSMUST00000163734] [ENSMUST00000172525] [ENSMUST00000173102] [ENSMUST00000173640] [ENSMUST00000173859] [ENSMUST00000174837]
Predicted Effect probably benign
Transcript: ENSMUST00000014920
SMART Domains Protein: ENSMUSP00000014920
Gene: ENSMUSG00000014776

DomainStartEndE-ValueType
CARD 4 92 2.1e-27 SMART
low complexity region 149 161 N/A INTRINSIC
low complexity region 173 209 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036127
AA Change: R353K

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000048904
Gene: ENSMUSG00000033249
AA Change: R353K

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 383 8e-88 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000036221
SMART Domains Protein: ENSMUSP00000038638
Gene: ENSMUSG00000033313

DomainStartEndE-ValueType
FBOX 8 48 2.72e-6 SMART
low complexity region 102 113 N/A INTRINSIC
low complexity region 252 263 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126923
SMART Domains Protein: ENSMUSP00000115366
Gene: ENSMUSG00000033313

DomainStartEndE-ValueType
FBOX 8 48 2.72e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163734
AA Change: R293K

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000126278
Gene: ENSMUSG00000033249
AA Change: R293K

DomainStartEndE-ValueType
HSF 9 60 1.43e-1 SMART
Blast:HSF 99 323 2e-88 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000172525
AA Change: G277R

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134206
Gene: ENSMUSG00000033249
AA Change: G277R

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 243 3e-36 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173102
Predicted Effect probably benign
Transcript: ENSMUST00000173640
SMART Domains Protein: ENSMUSP00000133532
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 284 1e-50 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173859
AA Change: R323K

PolyPhen 2 Score 0.294 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000134213
Gene: ENSMUSG00000033249
AA Change: R323K

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 353 1e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174837
SMART Domains Protein: ENSMUSP00000134477
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 290 3e-50 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heat-shock transcription factors (HSFs) activate heat-shock response genes under conditions of heat or other stresses. HSF4 lacks the carboxyl-terminal hydrophobic repeat which is shared among all vertebrate HSFs and has been suggested to be involved in the negative regulation of DNA binding activity. Two alternatively spliced transcripts encoding distinct isoforms and possessing different transcriptional activity have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display abnormal lens morphology and cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G T 4: 53,075,555 R999S possibly damaging Het
Ankrd31 T A 13: 96,826,209 Y503N probably damaging Het
Anks4b A G 7: 120,182,718 E324G probably benign Het
Arhgap44 CTGCT CTGCTTGCT 11: 65,032,084 probably null Het
Armc4 T C 18: 7,286,838 D131G probably benign Het
Atl1 A T 12: 69,932,283 T162S possibly damaging Het
Atp2b2 A G 6: 113,793,767 Y394H probably damaging Het
Dennd2d A G 3: 106,492,460 H233R probably benign Het
Dhx16 G T 17: 35,883,874 M462I probably damaging Het
Hif3a T C 7: 17,050,561 Y253C probably damaging Het
Impg1 T C 9: 80,316,172 D754G probably benign Het
Keap1 T C 9: 21,230,839 S580G possibly damaging Het
Lrp6 T C 6: 134,464,518 K1162E probably benign Het
Lrrc31 C T 3: 30,691,169 V110I possibly damaging Het
Muc5b G T 7: 141,872,381 K4738N possibly damaging Het
Myo1a G T 10: 127,706,925 probably null Het
Olfr1491 A G 19: 13,705,060 T78A probably damaging Het
Olfr619 T A 7: 103,603,972 M106K probably damaging Het
Olfr832 A T 9: 18,945,044 Y132F probably damaging Het
Parp4 A T 14: 56,641,283 H1225L probably benign Het
Pcgf2 T C 11: 97,692,780 Y52C possibly damaging Het
Pkn3 T C 2: 30,088,584 probably null Het
Psen2 C A 1: 180,245,669 R29L possibly damaging Het
Rfx6 A G 10: 51,718,211 probably null Het
Rps13 T C 7: 116,331,573 T145A probably benign Het
Rsf1 A ACGGCGACGG 7: 97,579,904 probably null Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Smarca4 C T 9: 21,632,909 probably benign Het
Stat4 A T 1: 52,096,867 E445V probably damaging Het
Taf13 T A 3: 108,581,071 I90N probably damaging Het
Tas2r124 T A 6: 132,755,453 Y242N probably damaging Het
Tmem151b T C 17: 45,545,785 Y243C probably damaging Het
Wasl T C 6: 24,619,574 T316A unknown Het
Zbtb44 T C 9: 31,053,794 C167R probably damaging Het
Zc3h7b T C 15: 81,792,035 L714P possibly damaging Het
Zfp35 T A 18: 24,002,759 H53Q probably benign Het
Zfp804b A G 5: 6,769,043 V1340A probably benign Het
Other mutations in Hsf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Hsf4 APN 8 105275657 makesense probably null
IGL01702:Hsf4 APN 8 105271589 missense probably damaging 1.00
IGL02040:Hsf4 APN 8 105275667 unclassified probably benign
R0115:Hsf4 UTSW 8 105272704 critical splice acceptor site probably null
R0449:Hsf4 UTSW 8 105275590 missense probably benign 0.04
R0585:Hsf4 UTSW 8 105271031 missense probably damaging 1.00
R1365:Hsf4 UTSW 8 105271094 missense probably damaging 0.99
R1401:Hsf4 UTSW 8 105275603 missense probably benign
R2276:Hsf4 UTSW 8 105269996 missense probably null 0.91
R2278:Hsf4 UTSW 8 105269996 missense probably null 0.91
R3848:Hsf4 UTSW 8 105270837 missense probably damaging 1.00
R3850:Hsf4 UTSW 8 105270837 missense probably damaging 1.00
R4240:Hsf4 UTSW 8 105274881 missense possibly damaging 0.58
R4781:Hsf4 UTSW 8 105274752 critical splice donor site probably null
R4790:Hsf4 UTSW 8 105270605 missense probably damaging 1.00
R4917:Hsf4 UTSW 8 105272735 missense probably benign 0.00
R4918:Hsf4 UTSW 8 105272735 missense probably benign 0.00
R4930:Hsf4 UTSW 8 105272698 splice site probably null
R5110:Hsf4 UTSW 8 105272795 missense probably benign 0.01
R5189:Hsf4 UTSW 8 105271428 frame shift probably null
R6167:Hsf4 UTSW 8 105270849 missense probably damaging 1.00
R6802:Hsf4 UTSW 8 105274668 missense probably damaging 1.00
R7231:Hsf4 UTSW 8 105272147 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGCACTGCTCAAAGAAGAG -3'
(R):5'- ACTTGACTGGGAGTTTCCATTTTC -3'

Sequencing Primer
(F):5'- TCAAAGAAGAGCCGGCCAGTC -3'
(R):5'- GACTGGGAGTTTCCATTTTCTAAATG -3'
Posted On2017-06-26