Mutagenetix > Incidental Mutations

Incidental Mutation 'R6001:Atl1'

480845

Institutional Source

Beutler Lab

Gene Symbol

Atl1

Ensembl Gene

ENSMUSG00000021066

Gene Name

atlastin GTPase 1

Synonyms

AD-FSP, Spg3a, FSP1, SPG3

MMRRC Submission

044180-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.419) question?

Stock #

R6001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

69892614-69966417 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 69932283 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 162 (T162S)

Ref Sequence

ENSEMBL: ENSMUSP00000021466 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021466] [ENSMUST00000223456]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000021466
AA Change: T162S

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000021466
Gene: ENSMUSG00000021066
AA Change: T162S

Domain	Start	End	E-Value	Type
low complexity region	15	27	N/A	INTRINSIC
Pfam:GBP	43	314	2.3e-103	PFAM
low complexity region	350	363	N/A	INTRINSIC
Blast:HAMP	468	519	9e-8	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083393

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222141

Predicted Effect

probably benign
Transcript: ENSMUST00000223456

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 91.8%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the dynamin family of GTPases. The encoded protein interacts with tubule-shaping proteins of the endoplasmic reticulum. Mutations in the homologous human gene can cause hereditary spastic paraplegia. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous animals show a gait disturbance characterized by external rotation of the hind feet with footprint analysis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	G	T	4: 53,075,555	R999S	possibly damaging	Het
Ankrd31	T	A	13: 96,826,209	Y503N	probably damaging	Het
Anks4b	A	G	7: 120,182,718	E324G	probably benign	Het
Arhgap44	CTGCT	CTGCTTGCT	11: 65,032,084		probably null	Het
Armc4	T	C	18: 7,286,838	D131G	probably benign	Het
Atp2b2	A	G	6: 113,793,767	Y394H	probably damaging	Het
Dennd2d	A	G	3: 106,492,460	H233R	probably benign	Het
Dhx16	G	T	17: 35,883,874	M462I	probably damaging	Het
Hif3a	T	C	7: 17,050,561	Y253C	probably damaging	Het
Hsf4	G	A	8: 105,272,909	G277R	possibly damaging	Het
Impg1	T	C	9: 80,316,172	D754G	probably benign	Het
Keap1	T	C	9: 21,230,839	S580G	possibly damaging	Het
Lrp6	T	C	6: 134,464,518	K1162E	probably benign	Het
Lrrc31	C	T	3: 30,691,169	V110I	possibly damaging	Het
Muc5b	G	T	7: 141,872,381	K4738N	possibly damaging	Het
Myo1a	G	T	10: 127,706,925		probably null	Het
Olfr1491	A	G	19: 13,705,060	T78A	probably damaging	Het
Olfr619	T	A	7: 103,603,972	M106K	probably damaging	Het
Olfr832	A	T	9: 18,945,044	Y132F	probably damaging	Het
Parp4	A	T	14: 56,641,283	H1225L	probably benign	Het
Pcgf2	T	C	11: 97,692,780	Y52C	possibly damaging	Het
Pkn3	T	C	2: 30,088,584		probably null	Het
Psen2	C	A	1: 180,245,669	R29L	possibly damaging	Het
Rfx6	A	G	10: 51,718,211		probably null	Het
Rps13	T	C	7: 116,331,573	T145A	probably benign	Het
Rsf1	A	ACGGCGACGG	7: 97,579,904		probably null	Het
Rsf1	GCG	GCGACG	7: 97,579,907		probably benign	Het
Rsf1	G	A	7: 97,579,910		probably benign	Het
Smarca4	C	T	9: 21,632,909		probably benign	Het
Stat4	A	T	1: 52,096,867	E445V	probably damaging	Het
Taf13	T	A	3: 108,581,071	I90N	probably damaging	Het
Tas2r124	T	A	6: 132,755,453	Y242N	probably damaging	Het
Tmem151b	T	C	17: 45,545,785	Y243C	probably damaging	Het
Wasl	T	C	6: 24,619,574	T316A	unknown	Het
Zbtb44	T	C	9: 31,053,794	C167R	probably damaging	Het
Zc3h7b	T	C	15: 81,792,035	L714P	possibly damaging	Het
Zfp35	T	A	18: 24,002,759	H53Q	probably benign	Het
Zfp804b	A	G	5: 6,769,043	V1340A	probably benign	Het

Other mutations in Atl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00824:Atl1	APN	12	69932238	missense	probably damaging	0.99
IGL02035:Atl1	APN	12	69960544	unclassified	probably benign
IGL02229:Atl1	APN	12	69926025	missense	probably benign	0.01
IGL03282:Atl1	APN	12	69954464	missense	possibly damaging	0.87
IGL03374:Atl1	APN	12	69955367	missense	probably damaging	1.00
R1538:Atl1	UTSW	12	69926188	missense	probably benign	0.02
R1819:Atl1	UTSW	12	69963300	missense	probably benign
R1903:Atl1	UTSW	12	69959275	missense	probably damaging	0.98
R1961:Atl1	UTSW	12	69953500	missense	probably benign	0.00
R1990:Atl1	UTSW	12	69963328	missense	probably damaging	1.00
R2126:Atl1	UTSW	12	69931657	splice site	probably null
R3724:Atl1	UTSW	12	69959380	missense	probably damaging	0.99
R4402:Atl1	UTSW	12	69959199	missense	probably benign	0.09
R5241:Atl1	UTSW	12	69959113	missense	possibly damaging	0.52
R5256:Atl1	UTSW	12	69959333	missense	probably damaging	1.00
R5285:Atl1	UTSW	12	69954499	missense	probably benign	0.18
R5866:Atl1	UTSW	12	69926011	missense	probably damaging	0.98
R6434:Atl1	UTSW	12	69959425	nonsense	probably null
R6677:Atl1	UTSW	12	69953444	missense	probably damaging	0.99
R6728:Atl1	UTSW	12	69947550	missense	possibly damaging	0.95
R6974:Atl1	UTSW	12	69926039	missense	probably damaging	0.99
R7013:Atl1	UTSW	12	69953440	missense	probably damaging	1.00
R7121:Atl1	UTSW	12	69931634	missense	probably damaging	0.99
R7224:Atl1	UTSW	12	69955353	missense	probably benign
R7437:Atl1	UTSW	12	69931622	missense	probably benign	0.37
R8043:Atl1	UTSW	12	69959215	missense	probably damaging	1.00
R8319:Atl1	UTSW	12	69955319	missense	probably damaging	0.99
Z1176:Atl1	UTSW	12	69937075	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- TAAAAGTGACTGTACCCAGCTGC -3'
(R):5'- GGCTACTCTTATGGAGCTGAATG -3'

Sequencing Primer
(F):5'- GTACCCAGCTGCTAATTAATATCC -3'
(R):5'- CTCTTATGGAGCTGAATGAGAACAC -3'

Posted On

2017-06-26