Incidental Mutation 'R6001:Atl1'
ID 480845
Institutional Source Beutler Lab
Gene Symbol Atl1
Ensembl Gene ENSMUSG00000021066
Gene Name atlastin GTPase 1
Synonyms AD-FSP, Spg3a, FSP1, SPG3
MMRRC Submission 044180-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.390) question?
Stock # R6001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 69892614-69966417 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 69932283 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 162 (T162S)
Ref Sequence ENSEMBL: ENSMUSP00000021466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021466] [ENSMUST00000223456]
AlphaFold Q8BH66
Predicted Effect possibly damaging
Transcript: ENSMUST00000021466
AA Change: T162S

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021466
Gene: ENSMUSG00000021066
AA Change: T162S

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:GBP 43 314 2.3e-103 PFAM
low complexity region 350 363 N/A INTRINSIC
Blast:HAMP 468 519 9e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083393
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222141
Predicted Effect probably benign
Transcript: ENSMUST00000223456
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the dynamin family of GTPases. The encoded protein interacts with tubule-shaping proteins of the endoplasmic reticulum. Mutations in the homologous human gene can cause hereditary spastic paraplegia. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous animals show a gait disturbance characterized by external rotation of the hind feet with footprint analysis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G T 4: 53,075,555 R999S possibly damaging Het
Ankrd31 T A 13: 96,826,209 Y503N probably damaging Het
Anks4b A G 7: 120,182,718 E324G probably benign Het
Arhgap44 CTGCT CTGCTTGCT 11: 65,032,084 probably null Het
Armc4 T C 18: 7,286,838 D131G probably benign Het
Atp2b2 A G 6: 113,793,767 Y394H probably damaging Het
Dennd2d A G 3: 106,492,460 H233R probably benign Het
Dhx16 G T 17: 35,883,874 M462I probably damaging Het
Hif3a T C 7: 17,050,561 Y253C probably damaging Het
Hsf4 G A 8: 105,272,909 G277R possibly damaging Het
Impg1 T C 9: 80,316,172 D754G probably benign Het
Keap1 T C 9: 21,230,839 S580G possibly damaging Het
Lrp6 T C 6: 134,464,518 K1162E probably benign Het
Lrrc31 C T 3: 30,691,169 V110I possibly damaging Het
Muc5b G T 7: 141,872,381 K4738N possibly damaging Het
Myo1a G T 10: 127,706,925 probably null Het
Olfr1491 A G 19: 13,705,060 T78A probably damaging Het
Olfr619 T A 7: 103,603,972 M106K probably damaging Het
Olfr832 A T 9: 18,945,044 Y132F probably damaging Het
Parp4 A T 14: 56,641,283 H1225L probably benign Het
Pcgf2 T C 11: 97,692,780 Y52C possibly damaging Het
Pkn3 T C 2: 30,088,584 probably null Het
Psen2 C A 1: 180,245,669 R29L possibly damaging Het
Rfx6 A G 10: 51,718,211 probably null Het
Rps13 T C 7: 116,331,573 T145A probably benign Het
Rsf1 A ACGGCGACGG 7: 97,579,904 probably null Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Smarca4 C T 9: 21,632,909 probably benign Het
Stat4 A T 1: 52,096,867 E445V probably damaging Het
Taf13 T A 3: 108,581,071 I90N probably damaging Het
Tas2r124 T A 6: 132,755,453 Y242N probably damaging Het
Tmem151b T C 17: 45,545,785 Y243C probably damaging Het
Wasl T C 6: 24,619,574 T316A unknown Het
Zbtb44 T C 9: 31,053,794 C167R probably damaging Het
Zc3h7b T C 15: 81,792,035 L714P possibly damaging Het
Zfp35 T A 18: 24,002,759 H53Q probably benign Het
Zfp804b A G 5: 6,769,043 V1340A probably benign Het
Other mutations in Atl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00824:Atl1 APN 12 69932238 missense probably damaging 0.99
IGL02035:Atl1 APN 12 69960544 unclassified probably benign
IGL02229:Atl1 APN 12 69926025 missense probably benign 0.01
IGL03282:Atl1 APN 12 69954464 missense possibly damaging 0.87
IGL03374:Atl1 APN 12 69955367 missense probably damaging 1.00
R1538:Atl1 UTSW 12 69926188 missense probably benign 0.02
R1819:Atl1 UTSW 12 69963300 missense probably benign
R1903:Atl1 UTSW 12 69959275 missense probably damaging 0.98
R1961:Atl1 UTSW 12 69953500 missense probably benign 0.00
R1990:Atl1 UTSW 12 69963328 missense probably damaging 1.00
R2126:Atl1 UTSW 12 69931657 splice site probably null
R3724:Atl1 UTSW 12 69959380 missense probably damaging 0.99
R4402:Atl1 UTSW 12 69959199 missense probably benign 0.09
R5241:Atl1 UTSW 12 69959113 missense possibly damaging 0.52
R5256:Atl1 UTSW 12 69959333 missense probably damaging 1.00
R5285:Atl1 UTSW 12 69954499 missense probably benign 0.18
R5866:Atl1 UTSW 12 69926011 missense probably damaging 0.98
R6434:Atl1 UTSW 12 69959425 nonsense probably null
R6677:Atl1 UTSW 12 69953444 missense probably damaging 0.99
R6728:Atl1 UTSW 12 69947550 missense possibly damaging 0.95
R6974:Atl1 UTSW 12 69926039 missense probably damaging 0.99
R7013:Atl1 UTSW 12 69953440 missense probably damaging 1.00
R7121:Atl1 UTSW 12 69931634 missense probably damaging 0.99
R7224:Atl1 UTSW 12 69955353 missense probably benign
R7437:Atl1 UTSW 12 69931622 missense probably benign 0.37
R8043:Atl1 UTSW 12 69959215 missense probably damaging 1.00
R8319:Atl1 UTSW 12 69955319 missense probably damaging 0.99
R8843:Atl1 UTSW 12 69926148 missense probably damaging 0.98
Z1176:Atl1 UTSW 12 69937075 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TAAAAGTGACTGTACCCAGCTGC -3'
(R):5'- GGCTACTCTTATGGAGCTGAATG -3'

Sequencing Primer
(F):5'- GTACCCAGCTGCTAATTAATATCC -3'
(R):5'- CTCTTATGGAGCTGAATGAGAACAC -3'
Posted On 2017-06-26