Incidental Mutation 'R5992:Rp1'
ID480854
Institutional Source Beutler Lab
Gene Symbol Rp1
Ensembl Gene ENSMUSG00000025900
Gene Nameretinitis pigmentosa 1 (human)
SynonymsDcdc3, mG145, Orp1, oxygen-regulated protein 1, Rp1h
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R5992 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location3999557-4409241 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4148703 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 951 (F951L)
Ref Sequence ENSEMBL: ENSMUSP00000146439 (fasta)
Predicted Effect unknown
Transcript: ENSMUST00000208660
AA Change: F951L
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains, which bind microtubules and regulate microtubule polymerization. The encoded protein is a photoreceptor microtubule-associated protein and is required for correct stacking of outer segment disc. This protein and the RP1L1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. Because of its response to in vivo retinal oxygen levels, this protein was initially named ORP1 (oxygen-regulated protein-1). This protein was subsequently designated RP1 (retinitis pigmentosa 1) when it was found that mutations in this gene cause autosomal dominant retinitis pigmentosa. Mutations in this gene also cause autosomal recessive retinitis pigmentosa. Two transcript variants encoding distinct isoforms are resulted from alternative promoters and alternative splicing. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene experience progressive degeneration in photoreceptors but are otherwise phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,508,623 L188* probably null Het
Acod1 C T 14: 103,055,035 R332C probably damaging Het
Adamts3 T A 5: 89,691,335 K852M probably damaging Het
Adm A T 7: 110,627,696 probably benign Het
Aff4 A G 11: 53,373,010 S286G probably damaging Het
Ank2 A G 3: 126,959,651 probably null Het
Aqr A T 2: 114,143,049 Y427* probably null Het
Arid1b C A 17: 4,994,956 probably benign Het
Arpp21 T A 9: 112,143,485 R259* probably null Het
Cep290 C T 10: 100,543,321 A55V possibly damaging Het
Chsy3 GT G 18: 59,176,166 probably null Het
Clcn2 T C 16: 20,713,654 E68G possibly damaging Het
Corin T A 5: 72,316,389 H699L probably benign Het
Cyld T C 8: 88,733,053 Y446H probably damaging Het
Dcst1 T A 3: 89,352,576 E613V probably damaging Het
Dlk1 T C 12: 109,455,581 C74R probably damaging Het
Dnah12 A C 14: 26,697,341 K128T probably benign Het
Dspp T A 5: 104,178,451 S893R unknown Het
Dtl A T 1: 191,568,572 probably null Het
F2rl1 T A 13: 95,514,270 S35C probably benign Het
Fcgbp A T 7: 28,120,534 Y2562F probably benign Het
Fgf10 A T 13: 118,715,508 D42V probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm21190 T A 5: 15,524,851 E256D probably damaging Het
Gm5157 A G 7: 21,185,421 S66P probably damaging Het
Gm884 A T 11: 103,613,792 M2450K possibly damaging Het
Hal T G 10: 93,490,916 L138R probably damaging Het
Hsd17b3 T C 13: 64,059,470 probably null Het
Lrsam1 T C 2: 32,955,222 T94A probably benign Het
Macc1 T C 12: 119,447,585 V696A probably damaging Het
Magi2 G A 5: 19,227,291 M1I probably null Het
March7 C A 2: 60,245,220 N674K probably benign Het
Mfap1b A G 2: 121,470,295 V34A probably benign Het
Mob3b G A 4: 35,084,069 S40L probably benign Het
Ndufs2 A T 1: 171,236,418 V386E probably damaging Het
Nfic C T 10: 81,420,747 A19T probably damaging Het
Nfs1 G A 2: 156,134,453 R174W probably damaging Het
Nin G T 12: 70,045,524 S670R possibly damaging Het
Nrxn1 T C 17: 90,623,507 I754V probably benign Het
Nwd1 T C 8: 72,653,573 probably null Het
Olfr1231 T A 2: 89,303,359 T78S possibly damaging Het
Olfr1238 T A 2: 89,406,879 M67L probably benign Het
Olfr575 G T 7: 102,955,009 N197K probably benign Het
Pcdhgb8 A G 18: 37,763,449 E524G probably damaging Het
Phlpp1 A T 1: 106,318,993 R638* probably null Het
Pkmyt1 G C 17: 23,735,326 W360S probably benign Het
Plxnd1 C A 6: 115,967,787 probably null Het
Poldip3 A T 15: 83,129,229 N322K probably damaging Het
Prmt3 A T 7: 49,828,947 I419L probably benign Het
Prss36 A T 7: 127,944,830 V123E probably damaging Het
Prss58 A G 6: 40,897,769 I46T probably damaging Het
Rac1 T C 5: 143,506,998 probably benign Het
Rb1cc1 A G 1: 6,233,996 Y36C probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rps6ka5 G T 12: 100,575,250 P417T possibly damaging Het
Ryr1 A G 7: 29,067,637 W2967R probably damaging Het
Sacs T A 14: 61,205,543 S1679R probably damaging Het
Scn1a A C 2: 66,335,456 W153G probably damaging Het
Serpinb7 A G 1: 107,445,996 Y114C probably damaging Het
Son T C 16: 91,658,904 M1513T probably benign Het
Spag8 C T 4: 43,651,534 V447M probably benign Het
St3gal2 T A 8: 110,969,553 Y257N probably damaging Het
Tars A T 15: 11,397,196 D40E probably damaging Het
Tlr3 T C 8: 45,397,814 H158R probably benign Het
Tppp2 G T 14: 51,918,935 V50L probably benign Het
Trrap T C 5: 144,810,184 S1503P probably benign Het
Ttll4 T G 1: 74,685,391 S573R probably damaging Het
Vmn2r104 A T 17: 20,029,485 N841K probably damaging Het
Vmn2r3 A T 3: 64,259,647 C688S probably damaging Het
Vps16 T C 2: 130,424,449 probably null Het
Zfp608 G A 18: 54,899,248 T540I probably benign Het
Zfp775 G A 6: 48,619,816 R208Q probably damaging Het
Other mutations in Rp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Rp1 APN 1 4346746 missense probably damaging 0.98
IGL00593:Rp1 APN 1 4345403 missense possibly damaging 0.70
IGL00956:Rp1 APN 1 4352212 missense probably damaging 1.00
IGL01070:Rp1 APN 1 4345238 missense probably damaging 1.00
IGL01531:Rp1 APN 1 4348945 missense probably benign 0.00
IGL01668:Rp1 APN 1 4345718 missense probably damaging 1.00
IGL01907:Rp1 APN 1 4348507 missense possibly damaging 0.56
IGL02055:Rp1 APN 1 4352522 missense probably damaging 1.00
IGL02071:Rp1 APN 1 4345310 missense possibly damaging 0.46
IGL02128:Rp1 APN 1 4347385 missense probably damaging 0.99
IGL02244:Rp1 APN 1 4348780 missense probably benign 0.00
IGL02381:Rp1 APN 1 4352390 missense probably benign 0.01
IGL02499:Rp1 APN 1 4349048 missense probably benign 0.17
IGL02619:Rp1 APN 1 4348450 missense possibly damaging 0.73
IGL02832:Rp1 APN 1 4349713 missense probably benign 0.03
IGL02861:Rp1 APN 1 4346152 nonsense probably null
IGL03288:Rp1 APN 1 4349524 missense possibly damaging 0.88
IGL03290:Rp1 APN 1 4350041 missense probably damaging 1.00
IGL03303:Rp1 APN 1 4344817 missense probably damaging 1.00
R0041:Rp1 UTSW 1 4344628 missense probably benign 0.36
R0111:Rp1 UTSW 1 4344760 missense probably damaging 1.00
R0363:Rp1 UTSW 1 4347718 missense probably damaging 1.00
R0440:Rp1 UTSW 1 4345640 missense probably damaging 1.00
R0442:Rp1 UTSW 1 4346747 missense probably benign 0.09
R0528:Rp1 UTSW 1 4344865 missense possibly damaging 0.82
R0586:Rp1 UTSW 1 4347837 missense possibly damaging 0.76
R0639:Rp1 UTSW 1 4346498 missense probably benign 0.00
R0856:Rp1 UTSW 1 4344655 missense probably benign 0.05
R0908:Rp1 UTSW 1 4344655 missense probably benign 0.05
R0968:Rp1 UTSW 1 4345352 missense probably benign 0.00
R1099:Rp1 UTSW 1 4352290 missense possibly damaging 0.45
R1242:Rp1 UTSW 1 4344962 missense probably benign 0.03
R1301:Rp1 UTSW 1 4345936 missense possibly damaging 0.56
R1327:Rp1 UTSW 1 4347970 missense probably benign 0.01
R1403:Rp1 UTSW 1 4346297 missense possibly damaging 0.73
R1403:Rp1 UTSW 1 4346297 missense possibly damaging 0.73
R1406:Rp1 UTSW 1 4351921 missense possibly damaging 0.88
R1406:Rp1 UTSW 1 4351921 missense possibly damaging 0.88
R1440:Rp1 UTSW 1 4347396 missense probably damaging 1.00
R1509:Rp1 UTSW 1 4347694 missense probably damaging 0.98
R1509:Rp1 UTSW 1 4348537 missense probably benign 0.20
R1538:Rp1 UTSW 1 4345676 missense probably damaging 1.00
R1609:Rp1 UTSW 1 4349201 missense probably damaging 1.00
R1666:Rp1 UTSW 1 4349863 missense probably damaging 1.00
R1703:Rp1 UTSW 1 4345169 missense probably damaging 1.00
R1782:Rp1 UTSW 1 4349089 missense probably benign 0.00
R1799:Rp1 UTSW 1 4348832 missense possibly damaging 0.94
R1848:Rp1 UTSW 1 4347232 missense possibly damaging 0.76
R1908:Rp1 UTSW 1 4348720 missense probably damaging 0.99
R1919:Rp1 UTSW 1 4352671 missense probably damaging 0.99
R2087:Rp1 UTSW 1 4348352 missense probably damaging 1.00
R2211:Rp1 UTSW 1 4348139 missense probably damaging 0.96
R2278:Rp1 UTSW 1 4348027 missense possibly damaging 0.51
R2287:Rp1 UTSW 1 4345959 nonsense probably null
R2316:Rp1 UTSW 1 4345640 missense probably damaging 1.00
R2346:Rp1 UTSW 1 4348013 missense probably damaging 1.00
R2878:Rp1 UTSW 1 4348139 missense probably damaging 1.00
R3023:Rp1 UTSW 1 4352675 missense probably damaging 1.00
R3025:Rp1 UTSW 1 4352675 missense probably damaging 1.00
R3716:Rp1 UTSW 1 4349765 missense probably benign 0.38
R3814:Rp1 UTSW 1 4349708 missense probably benign
R3929:Rp1 UTSW 1 4352645 missense probably damaging 1.00
R4064:Rp1 UTSW 1 4345400 missense probably benign 0.08
R4426:Rp1 UTSW 1 4347924 missense probably benign 0.13
R4557:Rp1 UTSW 1 4344663 missense possibly damaging 0.61
R4764:Rp1 UTSW 1 4345878 missense probably damaging 0.96
R4845:Rp1 UTSW 1 4349228 missense probably benign 0.02
R4850:Rp1 UTSW 1 4348675 missense probably damaging 1.00
R4857:Rp1 UTSW 1 4352316 missense probably damaging 0.99
R4857:Rp1 UTSW 1 4352317 missense probably damaging 1.00
R5159:Rp1 UTSW 1 4346203 missense possibly damaging 0.73
R5226:Rp1 UTSW 1 4348033 missense probably benign 0.01
R5327:Rp1 UTSW 1 4349360 intron probably null
R5352:Rp1 UTSW 1 4347098 missense probably benign 0.00
R5504:Rp1 UTSW 1 4349890 missense probably damaging 1.00
R5527:Rp1 UTSW 1 4346393 missense possibly damaging 0.75
R5529:Rp1 UTSW 1 4345832 missense probably benign 0.42
R5569:Rp1 UTSW 1 4345237 missense probably damaging 1.00
R5622:Rp1 UTSW 1 4347837 missense possibly damaging 0.76
R5970:Rp1 UTSW 1 4348462 missense probably benign 0.05
R6004:Rp1 UTSW 1 4197585 missense unknown
R6018:Rp1 UTSW 1 4352836 missense possibly damaging 0.83
R6074:Rp1 UTSW 1 4345379 missense probably benign 0.02
R6127:Rp1 UTSW 1 4349311 missense possibly damaging 0.80
R6187:Rp1 UTSW 1 4349869 missense probably damaging 1.00
R6301:Rp1 UTSW 1 4347254 missense probably benign 0.04
R6317:Rp1 UTSW 1 4041989 missense unknown
R6405:Rp1 UTSW 1 4345771 missense probably damaging 1.00
R6445:Rp1 UTSW 1 4226617 missense unknown
R6466:Rp1 UTSW 1 4347886 missense probably benign 0.01
R6501:Rp1 UTSW 1 4311280 intron probably benign
R6547:Rp1 UTSW 1 4170305 missense unknown
R6604:Rp1 UTSW 1 4019128 missense unknown
R6700:Rp1 UTSW 1 4349896 missense probably damaging 1.00
R6706:Rp1 UTSW 1 4142664 missense unknown
R6831:Rp1 UTSW 1 4349864 intron probably null
R6918:Rp1 UTSW 1 3999608 missense unknown
R6973:Rp1 UTSW 1 4351994 nonsense probably null
R6981:Rp1 UTSW 1 4345655 missense probably benign 0.06
R7009:Rp1 UTSW 1 4042068 missense unknown
R7078:Rp1 UTSW 1 4206791 missense unknown
R7112:Rp1 UTSW 1 4349018 missense probably benign 0.43
R7135:Rp1 UTSW 1 4348168 missense possibly damaging 0.83
R7165:Rp1 UTSW 1 4349917 missense probably damaging 0.99
R7199:Rp1 UTSW 1 4347290 missense possibly damaging 0.73
R7232:Rp1 UTSW 1 4228601 missense unknown
R7367:Rp1 UTSW 1 4347998 missense probably benign 0.42
R7484:Rp1 UTSW 1 4345481 missense probably benign 0.10
R7500:Rp1 UTSW 1 4311278 missense unknown
R7569:Rp1 UTSW 1 4284840 missense unknown
R7642:Rp1 UTSW 1 4147831 missense unknown
R7693:Rp1 UTSW 1 4347403 missense probably damaging 1.00
R7742:Rp1 UTSW 1 4170234 missense unknown
R7759:Rp1 UTSW 1 4344884 missense probably benign
R7784:Rp1 UTSW 1 4142658 missense unknown
R7816:Rp1 UTSW 1 4347703 missense probably damaging 0.98
R7866:Rp1 UTSW 1 4347701 missense probably benign 0.02
R7949:Rp1 UTSW 1 4347701 missense probably benign 0.02
R7950:Rp1 UTSW 1 4351873 intron probably null
RF003:Rp1 UTSW 1 4344694 missense probably damaging 0.99
V1662:Rp1 UTSW 1 4349560 missense probably damaging 1.00
X0012:Rp1 UTSW 1 4347695 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGACCAAAGCTGTGACACTG -3'
(R):5'- CTGCTAGTCAACCACTGCTAAC -3'

Sequencing Primer
(F):5'- GCTGTGACACTGAATAAGTCAC -3'
(R):5'- CAACAATCCTCCTTCTACAATAGTGG -3'
Posted On2017-06-26