Incidental Mutation 'R5992:Phlpp1'
ID 480857
Institutional Source Beutler Lab
Gene Symbol Phlpp1
Ensembl Gene ENSMUSG00000044340
Gene Name PH domain and leucine rich repeat protein phosphatase 1
Synonyms Plekhe1, Phlpp
Accession Numbers
Essential gene? Probably non essential (E-score: 0.123) question?
Stock # R5992 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 106099599-106321975 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 106246723 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 638 (R638*)
Ref Sequence ENSEMBL: ENSMUSP00000056530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061047]
AlphaFold Q8CHE4
Predicted Effect probably null
Transcript: ENSMUST00000061047
AA Change: R638*
SMART Domains Protein: ENSMUSP00000056530
Gene: ENSMUSG00000044340
AA Change: R638*

DomainStartEndE-ValueType
low complexity region 3 9 N/A INTRINSIC
low complexity region 21 27 N/A INTRINSIC
low complexity region 35 96 N/A INTRINSIC
low complexity region 97 143 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
low complexity region 209 226 N/A INTRINSIC
low complexity region 227 235 N/A INTRINSIC
low complexity region 257 277 N/A INTRINSIC
low complexity region 299 313 N/A INTRINSIC
low complexity region 335 345 N/A INTRINSIC
low complexity region 355 369 N/A INTRINSIC
PH 493 594 3.16e-2 SMART
LRR 615 634 4.75e2 SMART
LRR 648 669 7.16e0 SMART
LRR 669 688 1.48e1 SMART
LRR 692 714 2.14e1 SMART
LRR 715 738 1.37e1 SMART
LRR 786 809 3.27e1 SMART
LRR 849 868 8.11e0 SMART
LRR 872 895 1.97e1 SMART
LRR 895 914 2.55e1 SMART
LRR 919 940 1.86e1 SMART
LRR 941 960 1.67e1 SMART
LRR 991 1010 2.13e1 SMART
LRR 1015 1038 5.11e0 SMART
PP2Cc 1121 1376 2.62e-58 SMART
low complexity region 1393 1407 N/A INTRINSIC
low complexity region 1424 1445 N/A INTRINSIC
Blast:PP2Cc 1463 1555 2e-39 BLAST
low complexity region 1608 1624 N/A INTRINSIC
low complexity region 1640 1671 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124895
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine phosphatase family. The encoded protein promotes apoptosis by dephosphorylating and inactivating the serine/threonine kinase Akt, and functions as a tumor suppressor in multiple types of cancer. Increased expression of this gene may also play a role in obesity and type 2 diabetes by interfering with Akt-mediated insulin signaling. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a null mutation display impairment in the ability to stabilize the circadian period after light induced resetting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,819,549 (GRCm39) L188* probably null Het
Acod1 C T 14: 103,292,471 (GRCm39) R332C probably damaging Het
Adamts3 T A 5: 89,839,194 (GRCm39) K852M probably damaging Het
Adm A T 7: 110,226,903 (GRCm39) probably benign Het
Aff4 A G 11: 53,263,837 (GRCm39) S286G probably damaging Het
Ank2 A G 3: 126,753,300 (GRCm39) probably null Het
Aqr A T 2: 113,973,530 (GRCm39) Y427* probably null Het
Arid1b C A 17: 5,045,231 (GRCm39) probably benign Het
Arpp21 T A 9: 111,972,553 (GRCm39) R259* probably null Het
Cep290 C T 10: 100,379,183 (GRCm39) A55V possibly damaging Het
Chsy3 GT G 18: 59,309,238 (GRCm39) 163 probably null Het
Clcn2 T C 16: 20,532,404 (GRCm39) E68G possibly damaging Het
Corin T A 5: 72,473,732 (GRCm39) H699L probably benign Het
Cyld T C 8: 89,459,681 (GRCm39) Y446H probably damaging Het
Dcst1 T A 3: 89,259,883 (GRCm39) E613V probably damaging Het
Dlk1 T C 12: 109,421,507 (GRCm39) C74R probably damaging Het
Dnah12 A C 14: 26,418,496 (GRCm39) K128T probably benign Het
Dspp T A 5: 104,326,317 (GRCm39) S893R unknown Het
Dtl A T 1: 191,300,684 (GRCm39) probably null Het
F2rl1 T A 13: 95,650,778 (GRCm39) S35C probably benign Het
Fcgbp A T 7: 27,819,959 (GRCm39) Y2562F probably benign Het
Fgf10 A T 13: 118,852,044 (GRCm39) D42V probably benign Het
Gm10271 A T 10: 116,808,497 (GRCm39) F6L probably damaging Het
Gm21190 T A 5: 15,729,849 (GRCm39) E256D probably damaging Het
Gm5157 A G 7: 20,919,346 (GRCm39) S66P probably damaging Het
Hal T G 10: 93,326,778 (GRCm39) L138R probably damaging Het
Hsd17b3 T C 13: 64,207,284 (GRCm39) probably null Het
Lrrc37 A T 11: 103,504,618 (GRCm39) M2450K possibly damaging Het
Lrsam1 T C 2: 32,845,234 (GRCm39) T94A probably benign Het
Macc1 T C 12: 119,411,320 (GRCm39) V696A probably damaging Het
Magi2 G A 5: 19,432,289 (GRCm39) M1I probably null Het
Marchf7 C A 2: 60,075,564 (GRCm39) N674K probably benign Het
Mfap1b A G 2: 121,300,776 (GRCm39) V34A probably benign Het
Mob3b G A 4: 35,084,069 (GRCm39) S40L probably benign Het
Ndufs2 A T 1: 171,063,987 (GRCm39) V386E probably damaging Het
Nfic C T 10: 81,256,581 (GRCm39) A19T probably damaging Het
Nfs1 G A 2: 155,976,373 (GRCm39) R174W probably damaging Het
Nin G T 12: 70,092,298 (GRCm39) S670R possibly damaging Het
Nrxn1 T C 17: 90,930,935 (GRCm39) I754V probably benign Het
Nwd1 T C 8: 73,380,201 (GRCm39) probably null Het
Or4a39 T A 2: 89,237,223 (GRCm39) M67L probably benign Het
Or4c1 T A 2: 89,133,703 (GRCm39) T78S possibly damaging Het
Or51a6 G T 7: 102,604,216 (GRCm39) N197K probably benign Het
Pcdhgb8 A G 18: 37,896,502 (GRCm39) E524G probably damaging Het
Pkmyt1 G C 17: 23,954,300 (GRCm39) W360S probably benign Het
Plxnd1 C A 6: 115,944,748 (GRCm39) probably null Het
Poldip3 A T 15: 83,013,430 (GRCm39) N322K probably damaging Het
Prmt3 A T 7: 49,478,695 (GRCm39) I419L probably benign Het
Prss36 A T 7: 127,544,002 (GRCm39) V123E probably damaging Het
Prss58 A G 6: 40,874,703 (GRCm39) I46T probably damaging Het
Rac1 T C 5: 143,492,753 (GRCm39) probably benign Het
Rb1cc1 A G 1: 6,304,220 (GRCm39) Y36C probably damaging Het
Rif1 C G 2: 51,985,856 (GRCm39) L614V probably damaging Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Rp1 A T 1: 4,218,926 (GRCm39) F951L unknown Het
Rps6ka5 G T 12: 100,541,509 (GRCm39) P417T possibly damaging Het
Ryr1 A G 7: 28,767,062 (GRCm39) W2967R probably damaging Het
Sacs T A 14: 61,442,992 (GRCm39) S1679R probably damaging Het
Scn1a A C 2: 66,165,800 (GRCm39) W153G probably damaging Het
Serpinb7 A G 1: 107,373,726 (GRCm39) Y114C probably damaging Het
Son T C 16: 91,455,792 (GRCm39) M1513T probably benign Het
Spag8 C T 4: 43,651,534 (GRCm39) V447M probably benign Het
St3gal2 T A 8: 111,696,185 (GRCm39) Y257N probably damaging Het
Tars1 A T 15: 11,397,282 (GRCm39) D40E probably damaging Het
Tlr3 T C 8: 45,850,851 (GRCm39) H158R probably benign Het
Tppp2 G T 14: 52,156,392 (GRCm39) V50L probably benign Het
Trrap T C 5: 144,746,994 (GRCm39) S1503P probably benign Het
Ttll4 T G 1: 74,724,550 (GRCm39) S573R probably damaging Het
Vmn2r104 A T 17: 20,249,747 (GRCm39) N841K probably damaging Het
Vmn2r3 A T 3: 64,167,068 (GRCm39) C688S probably damaging Het
Vps16 T C 2: 130,266,369 (GRCm39) probably null Het
Zfp608 G A 18: 55,032,320 (GRCm39) T540I probably benign Het
Zfp775 G A 6: 48,596,750 (GRCm39) R208Q probably damaging Het
Other mutations in Phlpp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Phlpp1 APN 1 106,267,178 (GRCm39) missense probably damaging 1.00
IGL00848:Phlpp1 APN 1 106,303,985 (GRCm39) missense probably damaging 1.00
IGL01122:Phlpp1 APN 1 106,101,166 (GRCm39) missense possibly damaging 0.51
IGL01588:Phlpp1 APN 1 106,308,119 (GRCm39) missense probably damaging 1.00
IGL02145:Phlpp1 APN 1 106,317,613 (GRCm39) missense probably damaging 0.96
IGL02417:Phlpp1 APN 1 106,320,444 (GRCm39) missense probably benign 0.00
IGL02863:Phlpp1 APN 1 106,304,027 (GRCm39) splice site probably null
IGL03178:Phlpp1 APN 1 106,320,118 (GRCm39) missense probably damaging 0.99
R0400:Phlpp1 UTSW 1 106,320,664 (GRCm39) missense probably benign 0.35
R0423:Phlpp1 UTSW 1 106,267,345 (GRCm39) missense probably benign 0.03
R0449:Phlpp1 UTSW 1 106,278,308 (GRCm39) missense probably damaging 0.98
R0765:Phlpp1 UTSW 1 106,320,013 (GRCm39) missense probably damaging 1.00
R0884:Phlpp1 UTSW 1 106,317,395 (GRCm39) splice site probably null
R1394:Phlpp1 UTSW 1 106,278,348 (GRCm39) missense possibly damaging 0.82
R1395:Phlpp1 UTSW 1 106,278,348 (GRCm39) missense possibly damaging 0.82
R1428:Phlpp1 UTSW 1 106,308,155 (GRCm39) splice site probably null
R1438:Phlpp1 UTSW 1 106,101,142 (GRCm39) missense possibly damaging 0.53
R1521:Phlpp1 UTSW 1 106,320,049 (GRCm39) missense probably damaging 1.00
R1572:Phlpp1 UTSW 1 106,320,519 (GRCm39) missense probably damaging 1.00
R1588:Phlpp1 UTSW 1 106,308,115 (GRCm39) missense probably damaging 1.00
R1843:Phlpp1 UTSW 1 106,271,235 (GRCm39) missense probably benign 0.40
R1889:Phlpp1 UTSW 1 106,246,580 (GRCm39) missense possibly damaging 0.95
R2404:Phlpp1 UTSW 1 106,100,569 (GRCm39) missense probably benign 0.22
R2942:Phlpp1 UTSW 1 106,100,502 (GRCm39) missense probably benign 0.00
R3774:Phlpp1 UTSW 1 106,320,921 (GRCm39) small deletion probably benign
R3832:Phlpp1 UTSW 1 106,320,327 (GRCm39) missense probably damaging 1.00
R4029:Phlpp1 UTSW 1 106,320,279 (GRCm39) missense probably damaging 0.98
R4086:Phlpp1 UTSW 1 106,274,891 (GRCm39) missense probably benign 0.03
R4112:Phlpp1 UTSW 1 106,292,068 (GRCm39) missense probably damaging 1.00
R4472:Phlpp1 UTSW 1 106,314,176 (GRCm39) missense probably damaging 1.00
R4654:Phlpp1 UTSW 1 106,267,231 (GRCm39) missense probably benign 0.00
R4908:Phlpp1 UTSW 1 106,317,481 (GRCm39) missense probably damaging 1.00
R5027:Phlpp1 UTSW 1 106,209,201 (GRCm39) missense probably damaging 1.00
R5199:Phlpp1 UTSW 1 106,101,124 (GRCm39) missense probably damaging 0.98
R5352:Phlpp1 UTSW 1 106,100,455 (GRCm39) missense probably benign 0.07
R5508:Phlpp1 UTSW 1 106,292,120 (GRCm39) missense probably benign 0.02
R5570:Phlpp1 UTSW 1 106,101,162 (GRCm39) missense probably benign 0.01
R5590:Phlpp1 UTSW 1 106,320,657 (GRCm39) missense possibly damaging 0.95
R5838:Phlpp1 UTSW 1 106,274,862 (GRCm39) nonsense probably null
R5955:Phlpp1 UTSW 1 106,291,960 (GRCm39) splice site probably null
R6469:Phlpp1 UTSW 1 106,214,833 (GRCm39) missense probably damaging 1.00
R6821:Phlpp1 UTSW 1 106,314,174 (GRCm39) missense probably damaging 0.98
R6952:Phlpp1 UTSW 1 106,100,209 (GRCm39) missense probably benign 0.04
R7101:Phlpp1 UTSW 1 106,100,397 (GRCm39) missense possibly damaging 0.96
R7402:Phlpp1 UTSW 1 106,317,420 (GRCm39) missense probably damaging 1.00
R7425:Phlpp1 UTSW 1 106,320,303 (GRCm39) missense probably benign 0.00
R7692:Phlpp1 UTSW 1 106,209,132 (GRCm39) missense probably damaging 1.00
R7874:Phlpp1 UTSW 1 106,317,603 (GRCm39) missense probably benign 0.05
R7970:Phlpp1 UTSW 1 106,101,015 (GRCm39) missense probably damaging 1.00
R8080:Phlpp1 UTSW 1 106,320,706 (GRCm39) missense probably benign 0.00
R8133:Phlpp1 UTSW 1 106,100,522 (GRCm39) frame shift probably null
R8224:Phlpp1 UTSW 1 106,320,348 (GRCm39) missense probably damaging 1.00
R8503:Phlpp1 UTSW 1 106,320,019 (GRCm39) missense probably benign 0.00
R8830:Phlpp1 UTSW 1 106,278,333 (GRCm39) missense probably damaging 1.00
R8882:Phlpp1 UTSW 1 106,320,372 (GRCm39) missense probably benign 0.01
R9257:Phlpp1 UTSW 1 106,100,281 (GRCm39) missense possibly damaging 0.85
R9472:Phlpp1 UTSW 1 106,308,079 (GRCm39) missense probably damaging 0.99
R9691:Phlpp1 UTSW 1 106,246,699 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGTTCCTGAGTTCCCAAAAGG -3'
(R):5'- CTGTTCTCACTATAAAGCAAAGCC -3'

Sequencing Primer
(F):5'- CCCAAAAGGGAATGTCTCATTTC -3'
(R):5'- GCCATGTTATATTGCCTTCTGAAGAG -3'
Posted On 2017-06-26