Mutagenetix > Incidental Mutation

Incidental Mutation 'R5992:Serpinb7'

480858

Institutional Source

Beutler Lab

Gene Symbol

Serpinb7

Ensembl Gene

ENSMUSG00000067001

Gene Name

serine (or cysteine) peptidase inhibitor, clade B, member 7

Synonyms

megsin, 4631416M05Rik, ovalbumin

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.055) question?

Stock #

R5992 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

107399655-107452689 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 107445996 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 114 (Y114C)

Ref Sequence

ENSEMBL: ENSMUSP00000083896 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086690]

AlphaFold

Q9D695

Predicted Effect

probably damaging
Transcript: ENSMUST00000086690
AA Change: Y114C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000083896
Gene: ENSMUSG00000067001
AA Change: Y114C

Domain	Start	End	E-Value	Type
SERPIN	13	380	2.7e-121	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 91.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins which function as protease inhibitors. Expression of this gene is upregulated in IgA nephropathy and mutations have been found to cause palmoplantar keratoderma, Nagashima type. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars2	T	A	17: 45,508,623	L188*	probably null	Het
Acod1	C	T	14: 103,055,035	R332C	probably damaging	Het
Adamts3	T	A	5: 89,691,335	K852M	probably damaging	Het
Adm	A	T	7: 110,627,696		probably benign	Het
Aff4	A	G	11: 53,373,010	S286G	probably damaging	Het
Ank2	A	G	3: 126,959,651		probably null	Het
Aqr	A	T	2: 114,143,049	Y427*	probably null	Het
Arid1b	C	A	17: 4,994,956		probably benign	Het
Arpp21	T	A	9: 112,143,485	R259*	probably null	Het
Cep290	C	T	10: 100,543,321	A55V	possibly damaging	Het
Chsy3	GT	G	18: 59,176,166	163	probably null	Het
Clcn2	T	C	16: 20,713,654	E68G	possibly damaging	Het
Corin	T	A	5: 72,316,389	H699L	probably benign	Het
Cyld	T	C	8: 88,733,053	Y446H	probably damaging	Het
Dcst1	T	A	3: 89,352,576	E613V	probably damaging	Het
Dlk1	T	C	12: 109,455,581	C74R	probably damaging	Het
Dnah12	A	C	14: 26,697,341	K128T	probably benign	Het
Dspp	T	A	5: 104,178,451	S893R	unknown	Het
Dtl	A	T	1: 191,568,572		probably null	Het
F2rl1	T	A	13: 95,514,270	S35C	probably benign	Het
Fcgbp	A	T	7: 28,120,534	Y2562F	probably benign	Het
Fgf10	A	T	13: 118,715,508	D42V	probably benign	Het
Gm10271	A	T	10: 116,972,592	F6L	probably damaging	Het
Gm21190	T	A	5: 15,524,851	E256D	probably damaging	Het
Gm5157	A	G	7: 21,185,421	S66P	probably damaging	Het
Gm884	A	T	11: 103,613,792	M2450K	possibly damaging	Het
Hal	T	G	10: 93,490,916	L138R	probably damaging	Het
Hsd17b3	T	C	13: 64,059,470		probably null	Het
Lrsam1	T	C	2: 32,955,222	T94A	probably benign	Het
Macc1	T	C	12: 119,447,585	V696A	probably damaging	Het
Magi2	G	A	5: 19,227,291	M1I	probably null	Het
March7	C	A	2: 60,245,220	N674K	probably benign	Het
Mfap1b	A	G	2: 121,470,295	V34A	probably benign	Het
Mob3b	G	A	4: 35,084,069	S40L	probably benign	Het
Ndufs2	A	T	1: 171,236,418	V386E	probably damaging	Het
Nfic	C	T	10: 81,420,747	A19T	probably damaging	Het
Nfs1	G	A	2: 156,134,453	R174W	probably damaging	Het
Nin	G	T	12: 70,045,524	S670R	possibly damaging	Het
Nrxn1	T	C	17: 90,623,507	I754V	probably benign	Het
Nwd1	T	C	8: 72,653,573		probably null	Het
Olfr1231	T	A	2: 89,303,359	T78S	possibly damaging	Het
Olfr1238	T	A	2: 89,406,879	M67L	probably benign	Het
Olfr575	G	T	7: 102,955,009	N197K	probably benign	Het
Pcdhgb8	A	G	18: 37,763,449	E524G	probably damaging	Het
Phlpp1	A	T	1: 106,318,993	R638*	probably null	Het
Pkmyt1	G	C	17: 23,735,326	W360S	probably benign	Het
Plxnd1	C	A	6: 115,967,787		probably null	Het
Poldip3	A	T	15: 83,129,229	N322K	probably damaging	Het
Prmt3	A	T	7: 49,828,947	I419L	probably benign	Het
Prss36	A	T	7: 127,944,830	V123E	probably damaging	Het
Prss58	A	G	6: 40,897,769	I46T	probably damaging	Het
Rac1	T	C	5: 143,506,998		probably benign	Het
Rb1cc1	A	G	1: 6,233,996	Y36C	probably damaging	Het
Rif1	C	G	2: 52,095,844	L614V	probably damaging	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Rp1	A	T	1: 4,148,703	F951L	unknown	Het
Rps6ka5	G	T	12: 100,575,250	P417T	possibly damaging	Het
Ryr1	A	G	7: 29,067,637	W2967R	probably damaging	Het
Sacs	T	A	14: 61,205,543	S1679R	probably damaging	Het
Scn1a	A	C	2: 66,335,456	W153G	probably damaging	Het
Son	T	C	16: 91,658,904	M1513T	probably benign	Het
Spag8	C	T	4: 43,651,534	V447M	probably benign	Het
St3gal2	T	A	8: 110,969,553	Y257N	probably damaging	Het
Tars	A	T	15: 11,397,196	D40E	probably damaging	Het
Tlr3	T	C	8: 45,397,814	H158R	probably benign	Het
Tppp2	G	T	14: 51,918,935	V50L	probably benign	Het
Trrap	T	C	5: 144,810,184	S1503P	probably benign	Het
Ttll4	T	G	1: 74,685,391	S573R	probably damaging	Het
Vmn2r104	A	T	17: 20,029,485	N841K	probably damaging	Het
Vmn2r3	A	T	3: 64,259,647	C688S	probably damaging	Het
Vps16	T	C	2: 130,424,449		probably null	Het
Zfp608	G	A	18: 54,899,248	T540I	probably benign	Het
Zfp775	G	A	6: 48,619,816	R208Q	probably damaging	Het

Other mutations in Serpinb7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00971:Serpinb7	APN	1	107428246	utr 5 prime	probably benign
IGL01325:Serpinb7	APN	1	107435380	missense	probably damaging	0.98
IGL01595:Serpinb7	APN	1	107428322	missense	probably damaging	0.97
IGL01925:Serpinb7	APN	1	107451669	missense	probably benign	0.01
IGL02008:Serpinb7	APN	1	107448129	missense	possibly damaging	0.51
IGL02206:Serpinb7	APN	1	107435372	missense	possibly damaging	0.88
IGL02870:Serpinb7	APN	1	107450287	missense	probably damaging	1.00
IGL03010:Serpinb7	APN	1	107452011	utr 3 prime	probably benign
R0455:Serpinb7	UTSW	1	107451610	missense	possibly damaging	0.91
R0492:Serpinb7	UTSW	1	107452007	makesense	probably null
R0664:Serpinb7	UTSW	1	107428307	missense	probably damaging	0.98
R1495:Serpinb7	UTSW	1	107451660	nonsense	probably null
R1540:Serpinb7	UTSW	1	107428268	missense	possibly damaging	0.72
R1789:Serpinb7	UTSW	1	107450273	missense	possibly damaging	0.58
R1850:Serpinb7	UTSW	1	107428295	missense	probably damaging	1.00
R2962:Serpinb7	UTSW	1	107451726	missense	probably benign	0.00
R3151:Serpinb7	UTSW	1	107435351	nonsense	probably null
R3439:Serpinb7	UTSW	1	107428351	missense	probably damaging	1.00
R4064:Serpinb7	UTSW	1	107446036	missense	probably benign	0.09
R4590:Serpinb7	UTSW	1	107451833	missense	probably damaging	1.00
R5260:Serpinb7	UTSW	1	107434749	missense	possibly damaging	0.74
R5637:Serpinb7	UTSW	1	107428307	missense	probably damaging	1.00
R5914:Serpinb7	UTSW	1	107451850	missense	probably damaging	1.00
R6013:Serpinb7	UTSW	1	107450189	missense	probably benign
R6317:Serpinb7	UTSW	1	107451706	missense	probably damaging	1.00
R6494:Serpinb7	UTSW	1	107435346	nonsense	probably null
R7181:Serpinb7	UTSW	1	107450322	missense	probably benign	0.01
R8011:Serpinb7	UTSW	1	107434757	missense	possibly damaging	0.87
R8226:Serpinb7	UTSW	1	107448250	splice site	probably null
R9097:Serpinb7	UTSW	1	107450177	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGAAGCTGAGGTAGTGAACTTTAG -3'
(R):5'- CTTTCCATGTTTCAAGTAACCTGAC -3'

Sequencing Primer
(F):5'- GTAGTGAACTTTAGCCAGCAGCC -3'
(R):5'- CACTTGCCATGTGTCTCA -3'

Posted On

2017-06-26