Incidental Mutation 'R5992:Ndufs2'
ID480859
Institutional Source Beutler Lab
Gene Symbol Ndufs2
Ensembl Gene ENSMUSG00000013593
Gene NameNADH dehydrogenase (ubiquinone) Fe-S protein 2
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5992 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location171234853-171251388 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 171236418 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 386 (V386E)
Ref Sequence ENSEMBL: ENSMUSP00000106950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013737] [ENSMUST00000079957] [ENSMUST00000111318] [ENSMUST00000191871] [ENSMUST00000193973] [ENSMUST00000194778]
Predicted Effect probably damaging
Transcript: ENSMUST00000013737
AA Change: V412E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000013737
Gene: ENSMUSG00000013593
AA Change: V412E

DomainStartEndE-ValueType
Pfam:Complex1_49kDa 193 463 1.1e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079957
SMART Domains Protein: ENSMUSP00000078875
Gene: ENSMUSG00000058715

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:TCR_zetazeta 21 51 3.7e-19 PFAM
ITAM 62 82 9.62e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111318
AA Change: V386E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106950
Gene: ENSMUSG00000013593
AA Change: V386E

DomainStartEndE-ValueType
Pfam:Complex1_49kDa 193 236 2e-21 PFAM
Pfam:Complex1_49kDa 232 437 1.7e-105 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131286
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136976
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138069
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150997
Predicted Effect probably benign
Transcript: ENSMUST00000191871
SMART Domains Protein: ENSMUSP00000141942
Gene: ENSMUSG00000013593

DomainStartEndE-ValueType
Pfam:Complex1_49kDa 114 146 5.3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193973
SMART Domains Protein: ENSMUSP00000141240
Gene: ENSMUSG00000058715

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:TCR_zetazeta 21 53 4.7e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194778
SMART Domains Protein: ENSMUSP00000141370
Gene: ENSMUSG00000013593

DomainStartEndE-ValueType
Pfam:Complex1_49kDa 166 231 3.4e-28 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a core subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (complex I). Mammalian mitochondrial complex I is composed of at least 43 different subunits, 7 of which are encoded by the mitochondrial genome, and the rest are the products of nuclear genes. The iron-sulfur protein fraction of complex I is made up of 7 subunits, including this gene product. Complex I catalyzes the NADH oxidation with concomitant ubiquinone reduction and proton ejection out of the mitochondria. Mutations in this gene are associated with mitochondrial complex I deficiency. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,508,623 L188* probably null Het
Acod1 C T 14: 103,055,035 R332C probably damaging Het
Adamts3 T A 5: 89,691,335 K852M probably damaging Het
Adm A T 7: 110,627,696 probably benign Het
Aff4 A G 11: 53,373,010 S286G probably damaging Het
Ank2 A G 3: 126,959,651 probably null Het
Aqr A T 2: 114,143,049 Y427* probably null Het
Arid1b C A 17: 4,994,956 probably benign Het
Arpp21 T A 9: 112,143,485 R259* probably null Het
Cep290 C T 10: 100,543,321 A55V possibly damaging Het
Chsy3 GT G 18: 59,176,166 probably null Het
Clcn2 T C 16: 20,713,654 E68G possibly damaging Het
Corin T A 5: 72,316,389 H699L probably benign Het
Cyld T C 8: 88,733,053 Y446H probably damaging Het
Dcst1 T A 3: 89,352,576 E613V probably damaging Het
Dlk1 T C 12: 109,455,581 C74R probably damaging Het
Dnah12 A C 14: 26,697,341 K128T probably benign Het
Dspp T A 5: 104,178,451 S893R unknown Het
Dtl A T 1: 191,568,572 probably null Het
F2rl1 T A 13: 95,514,270 S35C probably benign Het
Fcgbp A T 7: 28,120,534 Y2562F probably benign Het
Fgf10 A T 13: 118,715,508 D42V probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm21190 T A 5: 15,524,851 E256D probably damaging Het
Gm5157 A G 7: 21,185,421 S66P probably damaging Het
Gm884 A T 11: 103,613,792 M2450K possibly damaging Het
Hal T G 10: 93,490,916 L138R probably damaging Het
Hsd17b3 T C 13: 64,059,470 probably null Het
Lrsam1 T C 2: 32,955,222 T94A probably benign Het
Macc1 T C 12: 119,447,585 V696A probably damaging Het
Magi2 G A 5: 19,227,291 M1I probably null Het
March7 C A 2: 60,245,220 N674K probably benign Het
Mfap1b A G 2: 121,470,295 V34A probably benign Het
Mob3b G A 4: 35,084,069 S40L probably benign Het
Nfic C T 10: 81,420,747 A19T probably damaging Het
Nfs1 G A 2: 156,134,453 R174W probably damaging Het
Nin G T 12: 70,045,524 S670R possibly damaging Het
Nrxn1 T C 17: 90,623,507 I754V probably benign Het
Nwd1 T C 8: 72,653,573 probably null Het
Olfr1231 T A 2: 89,303,359 T78S possibly damaging Het
Olfr1238 T A 2: 89,406,879 M67L probably benign Het
Olfr575 G T 7: 102,955,009 N197K probably benign Het
Pcdhgb8 A G 18: 37,763,449 E524G probably damaging Het
Phlpp1 A T 1: 106,318,993 R638* probably null Het
Pkmyt1 G C 17: 23,735,326 W360S probably benign Het
Plxnd1 C A 6: 115,967,787 probably null Het
Poldip3 A T 15: 83,129,229 N322K probably damaging Het
Prmt3 A T 7: 49,828,947 I419L probably benign Het
Prss36 A T 7: 127,944,830 V123E probably damaging Het
Prss58 A G 6: 40,897,769 I46T probably damaging Het
Rac1 T C 5: 143,506,998 probably benign Het
Rb1cc1 A G 1: 6,233,996 Y36C probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rp1 A T 1: 4,148,703 F951L unknown Het
Rps6ka5 G T 12: 100,575,250 P417T possibly damaging Het
Ryr1 A G 7: 29,067,637 W2967R probably damaging Het
Sacs T A 14: 61,205,543 S1679R probably damaging Het
Scn1a A C 2: 66,335,456 W153G probably damaging Het
Serpinb7 A G 1: 107,445,996 Y114C probably damaging Het
Son T C 16: 91,658,904 M1513T probably benign Het
Spag8 C T 4: 43,651,534 V447M probably benign Het
St3gal2 T A 8: 110,969,553 Y257N probably damaging Het
Tars A T 15: 11,397,196 D40E probably damaging Het
Tlr3 T C 8: 45,397,814 H158R probably benign Het
Tppp2 G T 14: 51,918,935 V50L probably benign Het
Trrap T C 5: 144,810,184 S1503P probably benign Het
Ttll4 T G 1: 74,685,391 S573R probably damaging Het
Vmn2r104 A T 17: 20,029,485 N841K probably damaging Het
Vmn2r3 A T 3: 64,259,647 C688S probably damaging Het
Vps16 T C 2: 130,424,449 probably null Het
Zfp608 G A 18: 54,899,248 T540I probably benign Het
Zfp775 G A 6: 48,619,816 R208Q probably damaging Het
Other mutations in Ndufs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01959:Ndufs2 APN 1 171237229 missense probably benign 0.45
IGL02367:Ndufs2 APN 1 171239365 nonsense probably null
R0905:Ndufs2 UTSW 1 171236353 unclassified probably null
R1618:Ndufs2 UTSW 1 171246121 missense probably benign 0.19
R3788:Ndufs2 UTSW 1 171235320 missense possibly damaging 0.81
R4866:Ndufs2 UTSW 1 171247049 missense probably benign 0.05
R4959:Ndufs2 UTSW 1 171238009 missense probably damaging 1.00
R5788:Ndufs2 UTSW 1 171239385 missense probably damaging 1.00
R6141:Ndufs2 UTSW 1 171236616 missense probably damaging 1.00
R6419:Ndufs2 UTSW 1 171241099 missense probably benign 0.12
R6480:Ndufs2 UTSW 1 171236698 missense probably damaging 1.00
R7034:Ndufs2 UTSW 1 171238308 missense probably benign 0.22
R7036:Ndufs2 UTSW 1 171238308 missense probably benign 0.22
R7854:Ndufs2 UTSW 1 171239369 missense probably damaging 1.00
R7937:Ndufs2 UTSW 1 171239369 missense probably damaging 1.00
R8023:Ndufs2 UTSW 1 171236694 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTACACAGAGAAACCCTGTC -3'
(R):5'- CATTGAAGCTCCTAAGGTGAGGG -3'

Sequencing Primer
(F):5'- TACACAGAGAAACCCTGTCTCAAAC -3'
(R):5'- CTGCTCACAGAGGTGTAA -3'
Posted On2017-06-26