Incidental Mutation 'R5992:Lrsam1'
ID480860
Institutional Source Beutler Lab
Gene Symbol Lrsam1
Ensembl Gene ENSMUSG00000026792
Gene Nameleucine rich repeat and sterile alpha motif containing 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R5992 (G1)
Quality Score150.008
Status Not validated
Chromosome2
Chromosomal Location32925216-32961614 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32955222 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 94 (T94A)
Ref Sequence ENSEMBL: ENSMUSP00000108825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028132] [ENSMUST00000113200] [ENSMUST00000124492] [ENSMUST00000127321] [ENSMUST00000133832] [ENSMUST00000145578] [ENSMUST00000147528] [ENSMUST00000191838]
Predicted Effect probably benign
Transcript: ENSMUST00000028132
AA Change: T94A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000028132
Gene: ENSMUSG00000026792
AA Change: T94A

DomainStartEndE-ValueType
LRR 80 102 1.26e1 SMART
LRR 103 125 9.3e-1 SMART
LRR 126 148 1.91e1 SMART
LRR 149 171 7.05e-1 SMART
Blast:IlGF 191 321 1e-71 BLAST
low complexity region 322 333 N/A INTRINSIC
low complexity region 474 493 N/A INTRINSIC
coiled coil region 500 547 N/A INTRINSIC
SAM 566 632 2.42e-2 SMART
RING 679 713 3.51e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113200
AA Change: T94A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000108825
Gene: ENSMUSG00000026792
AA Change: T94A

DomainStartEndE-ValueType
LRR 80 102 1.26e1 SMART
LRR 103 125 9.3e-1 SMART
LRR 126 148 1.91e1 SMART
LRR 149 171 7.05e-1 SMART
Blast:IlGF 191 321 1e-71 BLAST
low complexity region 322 333 N/A INTRINSIC
low complexity region 474 493 N/A INTRINSIC
coiled coil region 500 547 N/A INTRINSIC
SAM 566 632 2.42e-2 SMART
RING 679 713 3.51e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124492
Predicted Effect probably benign
Transcript: ENSMUST00000127321
AA Change: T94A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000115830
Gene: ENSMUSG00000026792
AA Change: T94A

DomainStartEndE-ValueType
LRR 80 102 1.26e1 SMART
LRR_TYP 103 126 1.79e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133832
AA Change: T94A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117194
Gene: ENSMUSG00000026792
AA Change: T94A

DomainStartEndE-ValueType
LRR 80 102 1.26e1 SMART
LRR_TYP 103 126 1.79e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145578
Predicted Effect probably benign
Transcript: ENSMUST00000147528
AA Change: T94A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122877
Gene: ENSMUSG00000026792
AA Change: T94A

DomainStartEndE-ValueType
Pfam:LRR_1 32 52 8.9e-2 PFAM
LRR 80 102 1.26e1 SMART
LRR 103 124 3.75e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191838
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ring finger protein involved in a variety of functions, including regulation of signaling pathways and cell adhesion, mediation of self-ubiquitylation, and involvement in cargo sorting during receptor endocytosis. Mutations in this gene have been associated with Charcot-Marie-Tooth disease. Multiple transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mutant mice either heterozygous or homozygous for a gene trapped allele exhibit mild neuromuscular junction and axonal defects in the absence of a neuronal challenge, but show increased sensitivity to acrylamide-induced motor axon degeneration relative to control mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,508,623 L188* probably null Het
Acod1 C T 14: 103,055,035 R332C probably damaging Het
Adamts3 T A 5: 89,691,335 K852M probably damaging Het
Adm A T 7: 110,627,696 probably benign Het
Aff4 A G 11: 53,373,010 S286G probably damaging Het
Ank2 A G 3: 126,959,651 probably null Het
Aqr A T 2: 114,143,049 Y427* probably null Het
Arid1b C A 17: 4,994,956 probably benign Het
Arpp21 T A 9: 112,143,485 R259* probably null Het
Cep290 C T 10: 100,543,321 A55V possibly damaging Het
Chsy3 GT G 18: 59,176,166 probably null Het
Clcn2 T C 16: 20,713,654 E68G possibly damaging Het
Corin T A 5: 72,316,389 H699L probably benign Het
Cyld T C 8: 88,733,053 Y446H probably damaging Het
Dcst1 T A 3: 89,352,576 E613V probably damaging Het
Dlk1 T C 12: 109,455,581 C74R probably damaging Het
Dnah12 A C 14: 26,697,341 K128T probably benign Het
Dspp T A 5: 104,178,451 S893R unknown Het
Dtl A T 1: 191,568,572 probably null Het
F2rl1 T A 13: 95,514,270 S35C probably benign Het
Fcgbp A T 7: 28,120,534 Y2562F probably benign Het
Fgf10 A T 13: 118,715,508 D42V probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm21190 T A 5: 15,524,851 E256D probably damaging Het
Gm5157 A G 7: 21,185,421 S66P probably damaging Het
Gm884 A T 11: 103,613,792 M2450K possibly damaging Het
Hal T G 10: 93,490,916 L138R probably damaging Het
Hsd17b3 T C 13: 64,059,470 probably null Het
Macc1 T C 12: 119,447,585 V696A probably damaging Het
Magi2 G A 5: 19,227,291 M1I probably null Het
March7 C A 2: 60,245,220 N674K probably benign Het
Mfap1b A G 2: 121,470,295 V34A probably benign Het
Mob3b G A 4: 35,084,069 S40L probably benign Het
Ndufs2 A T 1: 171,236,418 V386E probably damaging Het
Nfic C T 10: 81,420,747 A19T probably damaging Het
Nfs1 G A 2: 156,134,453 R174W probably damaging Het
Nin G T 12: 70,045,524 S670R possibly damaging Het
Nrxn1 T C 17: 90,623,507 I754V probably benign Het
Nwd1 T C 8: 72,653,573 probably null Het
Olfr1231 T A 2: 89,303,359 T78S possibly damaging Het
Olfr1238 T A 2: 89,406,879 M67L probably benign Het
Olfr575 G T 7: 102,955,009 N197K probably benign Het
Pcdhgb8 A G 18: 37,763,449 E524G probably damaging Het
Phlpp1 A T 1: 106,318,993 R638* probably null Het
Pkmyt1 G C 17: 23,735,326 W360S probably benign Het
Plxnd1 C A 6: 115,967,787 probably null Het
Poldip3 A T 15: 83,129,229 N322K probably damaging Het
Prmt3 A T 7: 49,828,947 I419L probably benign Het
Prss36 A T 7: 127,944,830 V123E probably damaging Het
Prss58 A G 6: 40,897,769 I46T probably damaging Het
Rac1 T C 5: 143,506,998 probably benign Het
Rb1cc1 A G 1: 6,233,996 Y36C probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rp1 A T 1: 4,148,703 F951L unknown Het
Rps6ka5 G T 12: 100,575,250 P417T possibly damaging Het
Ryr1 A G 7: 29,067,637 W2967R probably damaging Het
Sacs T A 14: 61,205,543 S1679R probably damaging Het
Scn1a A C 2: 66,335,456 W153G probably damaging Het
Serpinb7 A G 1: 107,445,996 Y114C probably damaging Het
Son T C 16: 91,658,904 M1513T probably benign Het
Spag8 C T 4: 43,651,534 V447M probably benign Het
St3gal2 T A 8: 110,969,553 Y257N probably damaging Het
Tars A T 15: 11,397,196 D40E probably damaging Het
Tlr3 T C 8: 45,397,814 H158R probably benign Het
Tppp2 G T 14: 51,918,935 V50L probably benign Het
Trrap T C 5: 144,810,184 S1503P probably benign Het
Ttll4 T G 1: 74,685,391 S573R probably damaging Het
Vmn2r104 A T 17: 20,029,485 N841K probably damaging Het
Vmn2r3 A T 3: 64,259,647 C688S probably damaging Het
Vps16 T C 2: 130,424,449 probably null Het
Zfp608 G A 18: 54,899,248 T540I probably benign Het
Zfp775 G A 6: 48,619,816 R208Q probably damaging Het
Other mutations in Lrsam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Lrsam1 APN 2 32955173 splice site probably benign
IGL01407:Lrsam1 APN 2 32947903 missense probably damaging 0.99
IGL01565:Lrsam1 APN 2 32936495 missense probably damaging 1.00
IGL01985:Lrsam1 APN 2 32928091 missense probably benign
IGL02743:Lrsam1 APN 2 32928649 splice site probably null
R0240:Lrsam1 UTSW 2 32955185 missense probably damaging 1.00
R0591:Lrsam1 UTSW 2 32933923 splice site probably benign
R0845:Lrsam1 UTSW 2 32953443 missense possibly damaging 0.94
R0945:Lrsam1 UTSW 2 32947909 missense probably benign 0.04
R1475:Lrsam1 UTSW 2 32954265 missense possibly damaging 0.48
R2147:Lrsam1 UTSW 2 32945879 missense probably damaging 1.00
R3790:Lrsam1 UTSW 2 32958159 missense probably null 1.00
R4374:Lrsam1 UTSW 2 32955191 missense possibly damaging 0.79
R4822:Lrsam1 UTSW 2 32926792 missense probably damaging 0.99
R5014:Lrsam1 UTSW 2 32936395 intron probably benign
R5472:Lrsam1 UTSW 2 32945858 frame shift probably null
R5566:Lrsam1 UTSW 2 32941858 missense probably damaging 1.00
R5640:Lrsam1 UTSW 2 32945852 missense probably benign 0.13
R7513:Lrsam1 UTSW 2 32953485 missense probably benign 0.02
R7515:Lrsam1 UTSW 2 32940239 critical splice donor site probably null
Z1176:Lrsam1 UTSW 2 32941814 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGCCGGGTCCTGGAAG -3'
(R):5'- GAAGACTATGAGCTGGTGAGC -3'

Sequencing Primer
(F):5'- AAGACTGTCACGGTCATGC -3'
(R):5'- AGTTTGAGACCAGCCTGATC -3'
Posted On2017-06-26