Incidental Mutation 'R5992:March7'
ID480862
Institutional Source Beutler Lab
Gene Symbol March7
Ensembl Gene ENSMUSG00000026977
Gene Namemembrane-associated ring finger (C3HC4) 7
SynonymsAxot, Gtrgeo17
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.396) question?
Stock #R5992 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location60209887-60250676 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 60245220 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 674 (N674K)
Ref Sequence ENSEMBL: ENSMUSP00000099809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067542] [ENSMUST00000102747] [ENSMUST00000102748]
Predicted Effect probably benign
Transcript: ENSMUST00000067542
AA Change: N674K

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000068961
Gene: ENSMUSG00000026977
AA Change: N674K

DomainStartEndE-ValueType
low complexity region 51 65 N/A INTRINSIC
low complexity region 76 85 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 216 234 N/A INTRINSIC
low complexity region 286 305 N/A INTRINSIC
low complexity region 324 338 N/A INTRINSIC
low complexity region 400 414 N/A INTRINSIC
low complexity region 451 463 N/A INTRINSIC
RINGv 553 610 2.11e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102747
AA Change: N674K

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099808
Gene: ENSMUSG00000026977
AA Change: N674K

DomainStartEndE-ValueType
low complexity region 51 65 N/A INTRINSIC
low complexity region 76 85 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 216 234 N/A INTRINSIC
low complexity region 286 305 N/A INTRINSIC
low complexity region 324 338 N/A INTRINSIC
low complexity region 400 414 N/A INTRINSIC
low complexity region 451 463 N/A INTRINSIC
RINGv 553 610 2.11e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102748
AA Change: N674K

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099809
Gene: ENSMUSG00000026977
AA Change: N674K

DomainStartEndE-ValueType
low complexity region 51 65 N/A INTRINSIC
low complexity region 76 85 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 216 234 N/A INTRINSIC
low complexity region 286 305 N/A INTRINSIC
low complexity region 324 338 N/A INTRINSIC
low complexity region 400 414 N/A INTRINSIC
low complexity region 451 463 N/A INTRINSIC
RINGv 553 610 2.11e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126986
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134905
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136367
Predicted Effect unknown
Transcript: ENSMUST00000142485
AA Change: N135K
SMART Domains Protein: ENSMUSP00000116925
Gene: ENSMUSG00000026977
AA Change: N135K

DomainStartEndE-ValueType
RINGv 15 72 2.11e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143806
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MARCH7 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH proteins add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments (Bartee et al., 2004 [PubMed 14722266]).[supplied by OMIM, Mar 2010]
PHENOTYPE: Homozygous null mice show premature neural degeneration and defective development of the corpus callosum. Both T cell proliferation and T cell-derived leukaemia inhibitory factor are increased. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,508,623 L188* probably null Het
Acod1 C T 14: 103,055,035 R332C probably damaging Het
Adamts3 T A 5: 89,691,335 K852M probably damaging Het
Adm A T 7: 110,627,696 probably benign Het
Aff4 A G 11: 53,373,010 S286G probably damaging Het
Ank2 A G 3: 126,959,651 probably null Het
Aqr A T 2: 114,143,049 Y427* probably null Het
Arid1b C A 17: 4,994,956 probably benign Het
Arpp21 T A 9: 112,143,485 R259* probably null Het
Cep290 C T 10: 100,543,321 A55V possibly damaging Het
Chsy3 GT G 18: 59,176,166 probably null Het
Clcn2 T C 16: 20,713,654 E68G possibly damaging Het
Corin T A 5: 72,316,389 H699L probably benign Het
Cyld T C 8: 88,733,053 Y446H probably damaging Het
Dcst1 T A 3: 89,352,576 E613V probably damaging Het
Dlk1 T C 12: 109,455,581 C74R probably damaging Het
Dnah12 A C 14: 26,697,341 K128T probably benign Het
Dspp T A 5: 104,178,451 S893R unknown Het
Dtl A T 1: 191,568,572 probably null Het
F2rl1 T A 13: 95,514,270 S35C probably benign Het
Fcgbp A T 7: 28,120,534 Y2562F probably benign Het
Fgf10 A T 13: 118,715,508 D42V probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm21190 T A 5: 15,524,851 E256D probably damaging Het
Gm5157 A G 7: 21,185,421 S66P probably damaging Het
Gm884 A T 11: 103,613,792 M2450K possibly damaging Het
Hal T G 10: 93,490,916 L138R probably damaging Het
Hsd17b3 T C 13: 64,059,470 probably null Het
Lrsam1 T C 2: 32,955,222 T94A probably benign Het
Macc1 T C 12: 119,447,585 V696A probably damaging Het
Magi2 G A 5: 19,227,291 M1I probably null Het
Mfap1b A G 2: 121,470,295 V34A probably benign Het
Mob3b G A 4: 35,084,069 S40L probably benign Het
Ndufs2 A T 1: 171,236,418 V386E probably damaging Het
Nfic C T 10: 81,420,747 A19T probably damaging Het
Nfs1 G A 2: 156,134,453 R174W probably damaging Het
Nin G T 12: 70,045,524 S670R possibly damaging Het
Nrxn1 T C 17: 90,623,507 I754V probably benign Het
Nwd1 T C 8: 72,653,573 probably null Het
Olfr1231 T A 2: 89,303,359 T78S possibly damaging Het
Olfr1238 T A 2: 89,406,879 M67L probably benign Het
Olfr575 G T 7: 102,955,009 N197K probably benign Het
Pcdhgb8 A G 18: 37,763,449 E524G probably damaging Het
Phlpp1 A T 1: 106,318,993 R638* probably null Het
Pkmyt1 G C 17: 23,735,326 W360S probably benign Het
Plxnd1 C A 6: 115,967,787 probably null Het
Poldip3 A T 15: 83,129,229 N322K probably damaging Het
Prmt3 A T 7: 49,828,947 I419L probably benign Het
Prss36 A T 7: 127,944,830 V123E probably damaging Het
Prss58 A G 6: 40,897,769 I46T probably damaging Het
Rac1 T C 5: 143,506,998 probably benign Het
Rb1cc1 A G 1: 6,233,996 Y36C probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rp1 A T 1: 4,148,703 F951L unknown Het
Rps6ka5 G T 12: 100,575,250 P417T possibly damaging Het
Ryr1 A G 7: 29,067,637 W2967R probably damaging Het
Sacs T A 14: 61,205,543 S1679R probably damaging Het
Scn1a A C 2: 66,335,456 W153G probably damaging Het
Serpinb7 A G 1: 107,445,996 Y114C probably damaging Het
Son T C 16: 91,658,904 M1513T probably benign Het
Spag8 C T 4: 43,651,534 V447M probably benign Het
St3gal2 T A 8: 110,969,553 Y257N probably damaging Het
Tars A T 15: 11,397,196 D40E probably damaging Het
Tlr3 T C 8: 45,397,814 H158R probably benign Het
Tppp2 G T 14: 51,918,935 V50L probably benign Het
Trrap T C 5: 144,810,184 S1503P probably benign Het
Ttll4 T G 1: 74,685,391 S573R probably damaging Het
Vmn2r104 A T 17: 20,029,485 N841K probably damaging Het
Vmn2r3 A T 3: 64,259,647 C688S probably damaging Het
Vps16 T C 2: 130,424,449 probably null Het
Zfp608 G A 18: 54,899,248 T540I probably benign Het
Zfp775 G A 6: 48,619,816 R208Q probably damaging Het
Other mutations in March7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:March7 APN 2 60234195 missense probably benign 0.01
IGL02001:March7 APN 2 60234891 missense possibly damaging 0.95
IGL02927:March7 APN 2 60236918 missense probably damaging 1.00
PIT4687001:March7 UTSW 2 60232278 missense probably damaging 1.00
R0379:March7 UTSW 2 60234126 missense probably benign 0.00
R1722:March7 UTSW 2 60234182 missense probably damaging 1.00
R1755:March7 UTSW 2 60234921 missense probably benign
R1759:March7 UTSW 2 60234544 missense probably damaging 1.00
R1809:March7 UTSW 2 60232293 missense probably benign 0.16
R2018:March7 UTSW 2 60229040 nonsense probably null
R2226:March7 UTSW 2 60229846 missense probably benign 0.13
R2227:March7 UTSW 2 60229846 missense probably benign 0.13
R2471:March7 UTSW 2 60236900 missense possibly damaging 0.80
R3724:March7 UTSW 2 60229745 missense probably benign 0.10
R4349:March7 UTSW 2 60234195 missense probably benign 0.01
R4667:March7 UTSW 2 60241050 nonsense probably null
R5365:March7 UTSW 2 60233914 missense possibly damaging 0.48
R5524:March7 UTSW 2 60245303 intron probably benign
R5860:March7 UTSW 2 60236843 missense probably damaging 1.00
R5883:March7 UTSW 2 60234442 missense probably damaging 1.00
R5945:March7 UTSW 2 60240987 missense probably damaging 1.00
R6937:March7 UTSW 2 60240966 missense probably damaging 1.00
R6944:March7 UTSW 2 60234243 missense probably benign 0.08
R6992:March7 UTSW 2 60229084 critical splice donor site probably null
R7337:March7 UTSW 2 60240845 intron probably null
R7448:March7 UTSW 2 60247514 critical splice donor site probably null
R7577:March7 UTSW 2 60229704 nonsense probably null
R7712:March7 UTSW 2 60234990 nonsense probably null
R7863:March7 UTSW 2 60241022 missense probably benign 0.35
R7946:March7 UTSW 2 60241022 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- TTGTGATACTGGTTTCCCCATG -3'
(R):5'- GGTTAAAATTACTTCCTTCCACACC -3'

Sequencing Primer
(F):5'- ACTGGTTTCCCCATGATTAATAATG -3'
(R):5'- ATGTTCAACCTTTATCACCCAAATC -3'
Posted On2017-06-26