Incidental Mutation 'R5992:Olfr1238'
ID480865
Institutional Source Beutler Lab
Gene Symbol Olfr1238
Ensembl Gene ENSMUSG00000111517
Gene Nameolfactory receptor 1238
SynonymsMOR231-11, GA_x6K02T2Q125-50849945-50848998
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R5992 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location89401991-89409676 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89406879 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 67 (M67L)
Ref Sequence ENSEMBL: ENSMUSP00000150367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099781] [ENSMUST00000217226] [ENSMUST00000217237]
Predicted Effect probably benign
Transcript: ENSMUST00000099781
AA Change: M67L

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000097369
Gene: ENSMUSG00000111517
AA Change: M67L

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 7.7e-46 PFAM
Pfam:7TM_GPCR_Srsx 33 300 1.1e-5 PFAM
Pfam:7tm_1 39 285 6.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215283
Predicted Effect probably benign
Transcript: ENSMUST00000217226
AA Change: M67L

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000217237
AA Change: M67L

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,508,623 L188* probably null Het
Acod1 C T 14: 103,055,035 R332C probably damaging Het
Adamts3 T A 5: 89,691,335 K852M probably damaging Het
Adm A T 7: 110,627,696 probably benign Het
Aff4 A G 11: 53,373,010 S286G probably damaging Het
Ank2 A G 3: 126,959,651 probably null Het
Aqr A T 2: 114,143,049 Y427* probably null Het
Arid1b C A 17: 4,994,956 probably benign Het
Arpp21 T A 9: 112,143,485 R259* probably null Het
Cep290 C T 10: 100,543,321 A55V possibly damaging Het
Chsy3 GT G 18: 59,176,166 probably null Het
Clcn2 T C 16: 20,713,654 E68G possibly damaging Het
Corin T A 5: 72,316,389 H699L probably benign Het
Cyld T C 8: 88,733,053 Y446H probably damaging Het
Dcst1 T A 3: 89,352,576 E613V probably damaging Het
Dlk1 T C 12: 109,455,581 C74R probably damaging Het
Dnah12 A C 14: 26,697,341 K128T probably benign Het
Dspp T A 5: 104,178,451 S893R unknown Het
Dtl A T 1: 191,568,572 probably null Het
F2rl1 T A 13: 95,514,270 S35C probably benign Het
Fcgbp A T 7: 28,120,534 Y2562F probably benign Het
Fgf10 A T 13: 118,715,508 D42V probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm21190 T A 5: 15,524,851 E256D probably damaging Het
Gm5157 A G 7: 21,185,421 S66P probably damaging Het
Gm884 A T 11: 103,613,792 M2450K possibly damaging Het
Hal T G 10: 93,490,916 L138R probably damaging Het
Hsd17b3 T C 13: 64,059,470 probably null Het
Lrsam1 T C 2: 32,955,222 T94A probably benign Het
Macc1 T C 12: 119,447,585 V696A probably damaging Het
Magi2 G A 5: 19,227,291 M1I probably null Het
March7 C A 2: 60,245,220 N674K probably benign Het
Mfap1b A G 2: 121,470,295 V34A probably benign Het
Mob3b G A 4: 35,084,069 S40L probably benign Het
Ndufs2 A T 1: 171,236,418 V386E probably damaging Het
Nfic C T 10: 81,420,747 A19T probably damaging Het
Nfs1 G A 2: 156,134,453 R174W probably damaging Het
Nin G T 12: 70,045,524 S670R possibly damaging Het
Nrxn1 T C 17: 90,623,507 I754V probably benign Het
Nwd1 T C 8: 72,653,573 probably null Het
Olfr1231 T A 2: 89,303,359 T78S possibly damaging Het
Olfr575 G T 7: 102,955,009 N197K probably benign Het
Pcdhgb8 A G 18: 37,763,449 E524G probably damaging Het
Phlpp1 A T 1: 106,318,993 R638* probably null Het
Pkmyt1 G C 17: 23,735,326 W360S probably benign Het
Plxnd1 C A 6: 115,967,787 probably null Het
Poldip3 A T 15: 83,129,229 N322K probably damaging Het
Prmt3 A T 7: 49,828,947 I419L probably benign Het
Prss36 A T 7: 127,944,830 V123E probably damaging Het
Prss58 A G 6: 40,897,769 I46T probably damaging Het
Rac1 T C 5: 143,506,998 probably benign Het
Rb1cc1 A G 1: 6,233,996 Y36C probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rp1 A T 1: 4,148,703 F951L unknown Het
Rps6ka5 G T 12: 100,575,250 P417T possibly damaging Het
Ryr1 A G 7: 29,067,637 W2967R probably damaging Het
Sacs T A 14: 61,205,543 S1679R probably damaging Het
Scn1a A C 2: 66,335,456 W153G probably damaging Het
Serpinb7 A G 1: 107,445,996 Y114C probably damaging Het
Son T C 16: 91,658,904 M1513T probably benign Het
Spag8 C T 4: 43,651,534 V447M probably benign Het
St3gal2 T A 8: 110,969,553 Y257N probably damaging Het
Tars A T 15: 11,397,196 D40E probably damaging Het
Tlr3 T C 8: 45,397,814 H158R probably benign Het
Tppp2 G T 14: 51,918,935 V50L probably benign Het
Trrap T C 5: 144,810,184 S1503P probably benign Het
Ttll4 T G 1: 74,685,391 S573R probably damaging Het
Vmn2r104 A T 17: 20,029,485 N841K probably damaging Het
Vmn2r3 A T 3: 64,259,647 C688S probably damaging Het
Vps16 T C 2: 130,424,449 probably null Het
Zfp608 G A 18: 54,899,248 T540I probably benign Het
Zfp775 G A 6: 48,619,816 R208Q probably damaging Het
Other mutations in Olfr1238
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01326:Olfr1238 APN 2 89406331 missense possibly damaging 0.95
IGL01648:Olfr1238 APN 2 89406191 missense probably damaging 0.99
IGL03005:Olfr1238 APN 2 89406971 missense possibly damaging 0.95
R0450:Olfr1238 UTSW 2 89406791 missense probably damaging 0.99
R0469:Olfr1238 UTSW 2 89406791 missense probably damaging 0.99
R0510:Olfr1238 UTSW 2 89406791 missense probably damaging 0.99
R1983:Olfr1238 UTSW 2 89406426 missense probably benign 0.00
R4183:Olfr1238 UTSW 2 89406591 missense probably benign
R4737:Olfr1238 UTSW 2 89406486 missense probably benign 0.05
R4748:Olfr1238 UTSW 2 89406255 missense probably benign 0.02
R4749:Olfr1238 UTSW 2 89406255 missense probably benign 0.02
R4969:Olfr1238 UTSW 2 89406426 missense probably benign 0.00
R5047:Olfr1238 UTSW 2 89406713 missense probably damaging 1.00
R6031:Olfr1238 UTSW 2 89406972 missense probably damaging 1.00
R6031:Olfr1238 UTSW 2 89406972 missense probably damaging 1.00
R6263:Olfr1238 UTSW 2 89406730 missense possibly damaging 0.80
R6416:Olfr1238 UTSW 2 89406522 missense possibly damaging 0.78
R7352:Olfr1238 UTSW 2 89406462 missense probably benign 0.00
R7515:Olfr1238 UTSW 2 89406906 missense possibly damaging 0.91
R7796:Olfr1238 UTSW 2 89406813 missense possibly damaging 0.73
R7893:Olfr1238 UTSW 2 89407070 missense probably benign 0.00
R7976:Olfr1238 UTSW 2 89407070 missense probably benign 0.00
R8034:Olfr1238 UTSW 2 89406737 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- ATGGCCACATAGCGATCGTAG -3'
(R):5'- CTGTTTTCCCAGTGAGAAACAATC -3'

Sequencing Primer
(F):5'- TAGCGATCGTAGGCCATCAC -3'
(R):5'- ATGTCACAGAATTTATCCTCCTGGG -3'
Posted On2017-06-26