Mutagenetix > Incidental Mutation

Incidental Mutation 'R5992:Aqr'

480866

Institutional Source

Beutler Lab

Gene Symbol

Aqr

Ensembl Gene

ENSMUSG00000040383

Gene Name

aquarius

Synonyms

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5992 (G1)

Quality Score

141.008

Status

Not validated

Chromosome

Chromosomal Location

114101170-114187024 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 114143049 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 427 (Y427*)

Ref Sequence

ENSEMBL: ENSMUSP00000099602 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043160] [ENSMUST00000102543]

AlphaFold

Q8CFQ3

Predicted Effect

probably null
Transcript: ENSMUST00000043160
AA Change: Y427*

SMART Domains

Protein: ENSMUSP00000047157
Gene: ENSMUSG00000040383
AA Change: Y427*

Domain	Start	End	E-Value	Type
Pfam:Aquarius_N	18	802	N/A	PFAM
Pfam:ResIII	797	911	8.2e-7	PFAM
Pfam:AAA_11	801	1111	9.6e-32	PFAM
Pfam:AAA_19	807	894	3.7e-11	PFAM
Pfam:AAA_12	1119	1312	2.1e-27	PFAM
low complexity region	1394	1417	N/A	INTRINSIC
low complexity region	1455	1468	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000102543
AA Change: Y427*

SMART Domains

Protein: ENSMUSP00000099602
Gene: ENSMUSG00000040383
AA Change: Y427*

Domain	Start	End	E-Value	Type
low complexity region	43	56	N/A	INTRINSIC
low complexity region	112	124	N/A	INTRINSIC
low complexity region	762	776	N/A	INTRINSIC
Pfam:AAA_11	801	1111	3.2e-32	PFAM
Pfam:AAA_19	807	893	6.5e-11	PFAM
Pfam:AAA_12	1119	1312	2.6e-27	PFAM
low complexity region	1348	1359	N/A	INTRINSIC
low complexity region	1371	1382	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125460

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126701

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 91.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in placental vascularization with few vessels entering the placenta and little branching. Mutants die between embryonic days 9.5 and 10.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars2	T	A	17: 45,508,623	L188*	probably null	Het
Acod1	C	T	14: 103,055,035	R332C	probably damaging	Het
Adamts3	T	A	5: 89,691,335	K852M	probably damaging	Het
Adm	A	T	7: 110,627,696		probably benign	Het
Aff4	A	G	11: 53,373,010	S286G	probably damaging	Het
Ank2	A	G	3: 126,959,651		probably null	Het
Arid1b	C	A	17: 4,994,956		probably benign	Het
Arpp21	T	A	9: 112,143,485	R259*	probably null	Het
Cep290	C	T	10: 100,543,321	A55V	possibly damaging	Het
Chsy3	GT	G	18: 59,176,166	163	probably null	Het
Clcn2	T	C	16: 20,713,654	E68G	possibly damaging	Het
Corin	T	A	5: 72,316,389	H699L	probably benign	Het
Cyld	T	C	8: 88,733,053	Y446H	probably damaging	Het
Dcst1	T	A	3: 89,352,576	E613V	probably damaging	Het
Dlk1	T	C	12: 109,455,581	C74R	probably damaging	Het
Dnah12	A	C	14: 26,697,341	K128T	probably benign	Het
Dspp	T	A	5: 104,178,451	S893R	unknown	Het
Dtl	A	T	1: 191,568,572		probably null	Het
F2rl1	T	A	13: 95,514,270	S35C	probably benign	Het
Fcgbp	A	T	7: 28,120,534	Y2562F	probably benign	Het
Fgf10	A	T	13: 118,715,508	D42V	probably benign	Het
Gm10271	A	T	10: 116,972,592	F6L	probably damaging	Het
Gm21190	T	A	5: 15,524,851	E256D	probably damaging	Het
Gm5157	A	G	7: 21,185,421	S66P	probably damaging	Het
Gm884	A	T	11: 103,613,792	M2450K	possibly damaging	Het
Hal	T	G	10: 93,490,916	L138R	probably damaging	Het
Hsd17b3	T	C	13: 64,059,470		probably null	Het
Lrsam1	T	C	2: 32,955,222	T94A	probably benign	Het
Macc1	T	C	12: 119,447,585	V696A	probably damaging	Het
Magi2	G	A	5: 19,227,291	M1I	probably null	Het
March7	C	A	2: 60,245,220	N674K	probably benign	Het
Mfap1b	A	G	2: 121,470,295	V34A	probably benign	Het
Mob3b	G	A	4: 35,084,069	S40L	probably benign	Het
Ndufs2	A	T	1: 171,236,418	V386E	probably damaging	Het
Nfic	C	T	10: 81,420,747	A19T	probably damaging	Het
Nfs1	G	A	2: 156,134,453	R174W	probably damaging	Het
Nin	G	T	12: 70,045,524	S670R	possibly damaging	Het
Nrxn1	T	C	17: 90,623,507	I754V	probably benign	Het
Nwd1	T	C	8: 72,653,573		probably null	Het
Olfr1231	T	A	2: 89,303,359	T78S	possibly damaging	Het
Olfr1238	T	A	2: 89,406,879	M67L	probably benign	Het
Olfr575	G	T	7: 102,955,009	N197K	probably benign	Het
Pcdhgb8	A	G	18: 37,763,449	E524G	probably damaging	Het
Phlpp1	A	T	1: 106,318,993	R638*	probably null	Het
Pkmyt1	G	C	17: 23,735,326	W360S	probably benign	Het
Plxnd1	C	A	6: 115,967,787		probably null	Het
Poldip3	A	T	15: 83,129,229	N322K	probably damaging	Het
Prmt3	A	T	7: 49,828,947	I419L	probably benign	Het
Prss36	A	T	7: 127,944,830	V123E	probably damaging	Het
Prss58	A	G	6: 40,897,769	I46T	probably damaging	Het
Rac1	T	C	5: 143,506,998		probably benign	Het
Rb1cc1	A	G	1: 6,233,996	Y36C	probably damaging	Het
Rif1	C	G	2: 52,095,844	L614V	probably damaging	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Rp1	A	T	1: 4,148,703	F951L	unknown	Het
Rps6ka5	G	T	12: 100,575,250	P417T	possibly damaging	Het
Ryr1	A	G	7: 29,067,637	W2967R	probably damaging	Het
Sacs	T	A	14: 61,205,543	S1679R	probably damaging	Het
Scn1a	A	C	2: 66,335,456	W153G	probably damaging	Het
Serpinb7	A	G	1: 107,445,996	Y114C	probably damaging	Het
Son	T	C	16: 91,658,904	M1513T	probably benign	Het
Spag8	C	T	4: 43,651,534	V447M	probably benign	Het
St3gal2	T	A	8: 110,969,553	Y257N	probably damaging	Het
Tars	A	T	15: 11,397,196	D40E	probably damaging	Het
Tlr3	T	C	8: 45,397,814	H158R	probably benign	Het
Tppp2	G	T	14: 51,918,935	V50L	probably benign	Het
Trrap	T	C	5: 144,810,184	S1503P	probably benign	Het
Ttll4	T	G	1: 74,685,391	S573R	probably damaging	Het
Vmn2r104	A	T	17: 20,029,485	N841K	probably damaging	Het
Vmn2r3	A	T	3: 64,259,647	C688S	probably damaging	Het
Vps16	T	C	2: 130,424,449		probably null	Het
Zfp608	G	A	18: 54,899,248	T540I	probably benign	Het
Zfp775	G	A	6: 48,619,816	R208Q	probably damaging	Het

Other mutations in Aqr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Aqr	APN	2	114125942	missense	possibly damaging	0.90
IGL00694:Aqr	APN	2	114151525	missense	probably damaging	1.00
IGL02113:Aqr	APN	2	114120027	nonsense	probably null
IGL02297:Aqr	APN	2	114150481	missense	probably benign	0.24
IGL02380:Aqr	APN	2	114109936	missense	probably damaging	1.00
IGL02410:Aqr	APN	2	114136917	missense	possibly damaging	0.85
IGL02413:Aqr	APN	2	114118780	missense	possibly damaging	0.87
IGL02474:Aqr	APN	2	114112646	missense	probably damaging	1.00
IGL02941:Aqr	APN	2	114113354	missense	probably damaging	1.00
IGL02981:Aqr	APN	2	114134824	splice site	probably benign
IGL03001:Aqr	APN	2	114146919	missense	probably benign
IGL03092:Aqr	APN	2	114158943	missense	probably benign	0.38
IGL03222:Aqr	APN	2	114121256	missense	probably damaging	1.00
capricorn	UTSW	2	114105882	missense	probably damaging	1.00
Goat	UTSW	2	114157575	missense	probably damaging	1.00
Pliades	UTSW	2	114132976	missense	probably damaging	1.00
sagittarius	UTSW	2	114149016	missense	probably damaging	1.00
Zodiac	UTSW	2	114108109	missense	probably damaging	0.96
PIT4531001:Aqr	UTSW	2	114130734	missense	possibly damaging	0.94
R0103:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R0103:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R0152:Aqr	UTSW	2	114159010	missense	probably benign	0.07
R0352:Aqr	UTSW	2	114170052	missense	probably damaging	1.00
R0371:Aqr	UTSW	2	114157604	missense	possibly damaging	0.80
R0374:Aqr	UTSW	2	114130611	missense	probably damaging	1.00
R0550:Aqr	UTSW	2	114132976	missense	probably damaging	1.00
R0604:Aqr	UTSW	2	114130604	missense	probably benign	0.00
R0685:Aqr	UTSW	2	114140977	missense	probably damaging	1.00
R1236:Aqr	UTSW	2	114116655	missense	probably damaging	1.00
R1434:Aqr	UTSW	2	114150409	missense	probably damaging	1.00
R1806:Aqr	UTSW	2	114161652	missense	probably damaging	1.00
R2154:Aqr	UTSW	2	114137004	missense	probably damaging	1.00
R2185:Aqr	UTSW	2	114130534	critical splice donor site	probably null
R2377:Aqr	UTSW	2	114140940	missense	possibly damaging	0.58
R2862:Aqr	UTSW	2	114136917	missense	probably damaging	1.00
R3615:Aqr	UTSW	2	114136887	missense	probably damaging	1.00
R3616:Aqr	UTSW	2	114136887	missense	probably damaging	1.00
R3713:Aqr	UTSW	2	114118669	splice site	probably benign
R3715:Aqr	UTSW	2	114118669	splice site	probably benign
R4586:Aqr	UTSW	2	114112577	missense	probably benign	0.06
R4663:Aqr	UTSW	2	114161666	nonsense	probably null
R4809:Aqr	UTSW	2	114175214	utr 5 prime	probably benign
R4887:Aqr	UTSW	2	114150509	missense	probably damaging	1.00
R4888:Aqr	UTSW	2	114150509	missense	probably damaging	1.00
R4952:Aqr	UTSW	2	114109937	missense	probably damaging	1.00
R4974:Aqr	UTSW	2	114113351	missense	probably damaging	1.00
R5050:Aqr	UTSW	2	114112609	nonsense	probably null
R5050:Aqr	UTSW	2	114170025	critical splice donor site	probably null
R5213:Aqr	UTSW	2	114113327	missense	probably damaging	1.00
R5263:Aqr	UTSW	2	114116578	missense	probably damaging	1.00
R5470:Aqr	UTSW	2	114157575	missense	probably damaging	1.00
R5488:Aqr	UTSW	2	114133073	missense	probably damaging	1.00
R5489:Aqr	UTSW	2	114133073	missense	probably damaging	1.00
R5567:Aqr	UTSW	2	114148970	missense	probably damaging	1.00
R5570:Aqr	UTSW	2	114148970	missense	probably damaging	1.00
R5641:Aqr	UTSW	2	114149034	missense	probably damaging	1.00
R5685:Aqr	UTSW	2	114156265	missense	possibly damaging	0.87
R5963:Aqr	UTSW	2	114126961	missense	probably damaging	1.00
R6015:Aqr	UTSW	2	114175165	start codon destroyed	probably null	0.53
R6253:Aqr	UTSW	2	114156277	missense	possibly damaging	0.93
R6264:Aqr	UTSW	2	114109964	missense	probably damaging	1.00
R6773:Aqr	UTSW	2	114148996	missense	possibly damaging	0.64
R6877:Aqr	UTSW	2	114116571	nonsense	probably null
R7211:Aqr	UTSW	2	114134723	missense	probably benign	0.01
R7232:Aqr	UTSW	2	114105882	missense	probably damaging	1.00
R7308:Aqr	UTSW	2	114104062	missense	possibly damaging	0.86
R7396:Aqr	UTSW	2	114119946	nonsense	probably null
R7490:Aqr	UTSW	2	114158868	critical splice donor site	probably null
R7526:Aqr	UTSW	2	114108109	missense	probably damaging	0.96
R7629:Aqr	UTSW	2	114114593	missense	probably damaging	1.00
R7828:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R8037:Aqr	UTSW	2	114161680	missense	probably damaging	1.00
R8166:Aqr	UTSW	2	114113325	missense	possibly damaging	0.95
R8712:Aqr	UTSW	2	114118877	missense	probably damaging	1.00
R8904:Aqr	UTSW	2	114136993	missense	probably damaging	0.98
R9487:Aqr	UTSW	2	114104047	missense	probably benign	0.04
R9527:Aqr	UTSW	2	114101556	missense	probably benign	0.02
R9664:Aqr	UTSW	2	114140915	nonsense	probably null
Z1176:Aqr	UTSW	2	114108122	missense	probably damaging	0.98
Z1176:Aqr	UTSW	2	114109991	missense	probably benign	0.25

Predicted Primers

PCR Primer
(F):5'- CTACTGTATAGAGGAGACGTGTG -3'
(R):5'- TCCAGCTCGAGTTCATTTGG -3'

Sequencing Primer
(F):5'- ATAGAGGAGACGTGTGTGCGTG -3'
(R):5'- GATTACCCTGGTGTCACT -3'

Posted On

2017-06-26