Incidental Mutation 'R5992:Ank2'
ID 480872
Institutional Source Beutler Lab
Gene Symbol Ank2
Ensembl Gene ENSMUSG00000032826
Gene Name ankyrin 2, brain
Synonyms Gm4392, Ank-2, ankyrin B, Ankyrin-B, Ankyrin-2
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5992 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 126715261-127292999 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 126753300 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044443] [ENSMUST00000182064] [ENSMUST00000182064] [ENSMUST00000182078] [ENSMUST00000182078] [ENSMUST00000182711] [ENSMUST00000182711] [ENSMUST00000182959]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000044443
SMART Domains Protein: ENSMUSP00000043765
Gene: ENSMUSG00000032826

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
low complexity region 57 69 N/A INTRINSIC
ZU5 128 232 4.13e-61 SMART
Pfam:ZU5 289 374 2.8e-8 PFAM
low complexity region 587 597 N/A INTRINSIC
DEATH 603 697 1.52e-27 SMART
low complexity region 732 748 N/A INTRINSIC
low complexity region 860 873 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182025
Predicted Effect probably benign
Transcript: ENSMUST00000182062
Predicted Effect probably null
Transcript: ENSMUST00000182064
SMART Domains Protein: ENSMUSP00000138620
Gene: ENSMUSG00000032826

DomainStartEndE-ValueType
ANK 9 38 1e1 SMART
ANK 42 71 8.9e-7 SMART
ANK 75 104 4.4e-9 SMART
ANK 108 137 2.8e-9 SMART
ANK 141 169 5.3e-1 SMART
ANK 170 199 7.3e-1 SMART
ANK 211 240 1.1e-7 SMART
ANK 244 273 4.4e-9 SMART
ANK 277 306 9.3e-8 SMART
ANK 310 339 2.1e-8 SMART
ANK 343 372 1.3e-7 SMART
ANK 376 405 6.2e-9 SMART
ANK 409 438 1.1e-7 SMART
ANK 442 471 2.9e-8 SMART
ANK 475 504 1.1e-5 SMART
ANK 508 537 6.5e-6 SMART
ANK 541 570 2.3e-7 SMART
ANK 574 603 2.4e-7 SMART
ANK 607 636 3.2e-9 SMART
ANK 640 669 5.5e-5 SMART
ANK 673 702 1.9e-8 SMART
ANK 706 735 3.3e-9 SMART
low complexity region 755 775 N/A INTRINSIC
low complexity region 793 806 N/A INTRINSIC
low complexity region 841 853 N/A INTRINSIC
ZU5 912 1016 2e-63 SMART
low complexity region 1371 1381 N/A INTRINSIC
low complexity region 1448 1463 N/A INTRINSIC
low complexity region 1490 1503 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000182064
SMART Domains Protein: ENSMUSP00000138620
Gene: ENSMUSG00000032826

DomainStartEndE-ValueType
ANK 9 38 1e1 SMART
ANK 42 71 8.9e-7 SMART
ANK 75 104 4.4e-9 SMART
ANK 108 137 2.8e-9 SMART
ANK 141 169 5.3e-1 SMART
ANK 170 199 7.3e-1 SMART
ANK 211 240 1.1e-7 SMART
ANK 244 273 4.4e-9 SMART
ANK 277 306 9.3e-8 SMART
ANK 310 339 2.1e-8 SMART
ANK 343 372 1.3e-7 SMART
ANK 376 405 6.2e-9 SMART
ANK 409 438 1.1e-7 SMART
ANK 442 471 2.9e-8 SMART
ANK 475 504 1.1e-5 SMART
ANK 508 537 6.5e-6 SMART
ANK 541 570 2.3e-7 SMART
ANK 574 603 2.4e-7 SMART
ANK 607 636 3.2e-9 SMART
ANK 640 669 5.5e-5 SMART
ANK 673 702 1.9e-8 SMART
ANK 706 735 3.3e-9 SMART
low complexity region 755 775 N/A INTRINSIC
low complexity region 793 806 N/A INTRINSIC
low complexity region 841 853 N/A INTRINSIC
ZU5 912 1016 2e-63 SMART
low complexity region 1371 1381 N/A INTRINSIC
low complexity region 1448 1463 N/A INTRINSIC
low complexity region 1490 1503 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000182078
SMART Domains Protein: ENSMUSP00000138753
Gene: ENSMUSG00000032826

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
low complexity region 114 125 N/A INTRINSIC
low complexity region 191 209 N/A INTRINSIC
low complexity region 304 312 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
low complexity region 527 544 N/A INTRINSIC
DEATH 591 685 1e-29 SMART
low complexity region 720 736 N/A INTRINSIC
low complexity region 848 861 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000182078
SMART Domains Protein: ENSMUSP00000138753
Gene: ENSMUSG00000032826

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
low complexity region 114 125 N/A INTRINSIC
low complexity region 191 209 N/A INTRINSIC
low complexity region 304 312 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
low complexity region 527 544 N/A INTRINSIC
DEATH 591 685 1e-29 SMART
low complexity region 720 736 N/A INTRINSIC
low complexity region 848 861 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000182711
SMART Domains Protein: ENSMUSP00000138781
Gene: ENSMUSG00000032826

DomainStartEndE-ValueType
ANK 26 55 1e1 SMART
ANK 59 88 8.9e-7 SMART
ANK 92 121 4.4e-9 SMART
ANK 125 154 2.8e-9 SMART
ANK 158 186 5.3e-1 SMART
ANK 187 216 7.3e-1 SMART
ANK 228 257 1.1e-7 SMART
ANK 261 290 4.4e-9 SMART
ANK 294 323 9.3e-8 SMART
ANK 327 356 2.1e-8 SMART
ANK 360 389 1.3e-7 SMART
ANK 393 422 6.2e-9 SMART
ANK 426 455 1.1e-7 SMART
ANK 459 488 2.9e-8 SMART
ANK 492 521 1.1e-5 SMART
ANK 525 554 6.5e-6 SMART
ANK 558 587 2.3e-7 SMART
ANK 591 620 5.3e-7 SMART
ANK 624 653 2.4e-7 SMART
ANK 657 686 3.2e-9 SMART
ANK 690 719 5.5e-5 SMART
ANK 723 752 1.9e-8 SMART
ANK 756 785 3.3e-9 SMART
low complexity region 805 825 N/A INTRINSIC
low complexity region 843 856 N/A INTRINSIC
ZU5 961 1098 1.1e-50 SMART
Predicted Effect probably null
Transcript: ENSMUST00000182711
SMART Domains Protein: ENSMUSP00000138781
Gene: ENSMUSG00000032826

DomainStartEndE-ValueType
ANK 26 55 1e1 SMART
ANK 59 88 8.9e-7 SMART
ANK 92 121 4.4e-9 SMART
ANK 125 154 2.8e-9 SMART
ANK 158 186 5.3e-1 SMART
ANK 187 216 7.3e-1 SMART
ANK 228 257 1.1e-7 SMART
ANK 261 290 4.4e-9 SMART
ANK 294 323 9.3e-8 SMART
ANK 327 356 2.1e-8 SMART
ANK 360 389 1.3e-7 SMART
ANK 393 422 6.2e-9 SMART
ANK 426 455 1.1e-7 SMART
ANK 459 488 2.9e-8 SMART
ANK 492 521 1.1e-5 SMART
ANK 525 554 6.5e-6 SMART
ANK 558 587 2.3e-7 SMART
ANK 591 620 5.3e-7 SMART
ANK 624 653 2.4e-7 SMART
ANK 657 686 3.2e-9 SMART
ANK 690 719 5.5e-5 SMART
ANK 723 752 1.9e-8 SMART
ANK 756 785 3.3e-9 SMART
low complexity region 805 825 N/A INTRINSIC
low complexity region 843 856 N/A INTRINSIC
ZU5 961 1098 1.1e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182959
SMART Domains Protein: ENSMUSP00000138251
Gene: ENSMUSG00000032826

DomainStartEndE-ValueType
ANK 9 38 1.63e3 SMART
ANK 42 71 1.4e-4 SMART
ANK 75 104 6.76e-7 SMART
ANK 108 137 4.46e-7 SMART
ANK 141 169 8.36e1 SMART
ANK 170 199 1.17e2 SMART
ANK 211 240 1.76e-5 SMART
ANK 244 273 6.76e-7 SMART
ANK 277 306 1.43e-5 SMART
ANK 310 339 3.33e-6 SMART
ANK 343 372 2.02e-5 SMART
ANK 376 405 9.55e-7 SMART
ANK 409 438 1.76e-5 SMART
ANK 442 471 4.71e-6 SMART
ANK 475 504 1.7e-3 SMART
ANK 508 537 1.05e-3 SMART
ANK 541 570 3.51e-5 SMART
ANK 574 603 8.65e-5 SMART
ANK 607 636 3.76e-5 SMART
ANK 640 669 5.12e-7 SMART
ANK 673 702 8.39e-3 SMART
ANK 706 735 2.9e-6 SMART
ANK 739 768 5.12e-7 SMART
low complexity region 788 808 N/A INTRINSIC
low complexity region 826 839 N/A INTRINSIC
low complexity region 874 886 N/A INTRINSIC
Pfam:ZU5 945 1028 1.5e-30 PFAM
Pfam:ZU5 1021 1082 4.4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183075
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in death by postnatal day 8, although some animals survive to P20. Mutant animals display reduced body size, impaired balance and locomotion, brain structure dysmorphologies, abnormal lens, and optic nerve degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,819,549 (GRCm39) L188* probably null Het
Acod1 C T 14: 103,292,471 (GRCm39) R332C probably damaging Het
Adamts3 T A 5: 89,839,194 (GRCm39) K852M probably damaging Het
Adm A T 7: 110,226,903 (GRCm39) probably benign Het
Aff4 A G 11: 53,263,837 (GRCm39) S286G probably damaging Het
Aqr A T 2: 113,973,530 (GRCm39) Y427* probably null Het
Arid1b C A 17: 5,045,231 (GRCm39) probably benign Het
Arpp21 T A 9: 111,972,553 (GRCm39) R259* probably null Het
Cep290 C T 10: 100,379,183 (GRCm39) A55V possibly damaging Het
Chsy3 GT G 18: 59,309,238 (GRCm39) 163 probably null Het
Clcn2 T C 16: 20,532,404 (GRCm39) E68G possibly damaging Het
Corin T A 5: 72,473,732 (GRCm39) H699L probably benign Het
Cyld T C 8: 89,459,681 (GRCm39) Y446H probably damaging Het
Dcst1 T A 3: 89,259,883 (GRCm39) E613V probably damaging Het
Dlk1 T C 12: 109,421,507 (GRCm39) C74R probably damaging Het
Dnah12 A C 14: 26,418,496 (GRCm39) K128T probably benign Het
Dspp T A 5: 104,326,317 (GRCm39) S893R unknown Het
Dtl A T 1: 191,300,684 (GRCm39) probably null Het
F2rl1 T A 13: 95,650,778 (GRCm39) S35C probably benign Het
Fcgbp A T 7: 27,819,959 (GRCm39) Y2562F probably benign Het
Fgf10 A T 13: 118,852,044 (GRCm39) D42V probably benign Het
Gm10271 A T 10: 116,808,497 (GRCm39) F6L probably damaging Het
Gm21190 T A 5: 15,729,849 (GRCm39) E256D probably damaging Het
Gm5157 A G 7: 20,919,346 (GRCm39) S66P probably damaging Het
Hal T G 10: 93,326,778 (GRCm39) L138R probably damaging Het
Hsd17b3 T C 13: 64,207,284 (GRCm39) probably null Het
Lrrc37 A T 11: 103,504,618 (GRCm39) M2450K possibly damaging Het
Lrsam1 T C 2: 32,845,234 (GRCm39) T94A probably benign Het
Macc1 T C 12: 119,411,320 (GRCm39) V696A probably damaging Het
Magi2 G A 5: 19,432,289 (GRCm39) M1I probably null Het
Marchf7 C A 2: 60,075,564 (GRCm39) N674K probably benign Het
Mfap1b A G 2: 121,300,776 (GRCm39) V34A probably benign Het
Mob3b G A 4: 35,084,069 (GRCm39) S40L probably benign Het
Ndufs2 A T 1: 171,063,987 (GRCm39) V386E probably damaging Het
Nfic C T 10: 81,256,581 (GRCm39) A19T probably damaging Het
Nfs1 G A 2: 155,976,373 (GRCm39) R174W probably damaging Het
Nin G T 12: 70,092,298 (GRCm39) S670R possibly damaging Het
Nrxn1 T C 17: 90,930,935 (GRCm39) I754V probably benign Het
Nwd1 T C 8: 73,380,201 (GRCm39) probably null Het
Or4a39 T A 2: 89,237,223 (GRCm39) M67L probably benign Het
Or4c1 T A 2: 89,133,703 (GRCm39) T78S possibly damaging Het
Or51a6 G T 7: 102,604,216 (GRCm39) N197K probably benign Het
Pcdhgb8 A G 18: 37,896,502 (GRCm39) E524G probably damaging Het
Phlpp1 A T 1: 106,246,723 (GRCm39) R638* probably null Het
Pkmyt1 G C 17: 23,954,300 (GRCm39) W360S probably benign Het
Plxnd1 C A 6: 115,944,748 (GRCm39) probably null Het
Poldip3 A T 15: 83,013,430 (GRCm39) N322K probably damaging Het
Prmt3 A T 7: 49,478,695 (GRCm39) I419L probably benign Het
Prss36 A T 7: 127,544,002 (GRCm39) V123E probably damaging Het
Prss58 A G 6: 40,874,703 (GRCm39) I46T probably damaging Het
Rac1 T C 5: 143,492,753 (GRCm39) probably benign Het
Rb1cc1 A G 1: 6,304,220 (GRCm39) Y36C probably damaging Het
Rif1 C G 2: 51,985,856 (GRCm39) L614V probably damaging Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Rp1 A T 1: 4,218,926 (GRCm39) F951L unknown Het
Rps6ka5 G T 12: 100,541,509 (GRCm39) P417T possibly damaging Het
Ryr1 A G 7: 28,767,062 (GRCm39) W2967R probably damaging Het
Sacs T A 14: 61,442,992 (GRCm39) S1679R probably damaging Het
Scn1a A C 2: 66,165,800 (GRCm39) W153G probably damaging Het
Serpinb7 A G 1: 107,373,726 (GRCm39) Y114C probably damaging Het
Son T C 16: 91,455,792 (GRCm39) M1513T probably benign Het
Spag8 C T 4: 43,651,534 (GRCm39) V447M probably benign Het
St3gal2 T A 8: 111,696,185 (GRCm39) Y257N probably damaging Het
Tars1 A T 15: 11,397,282 (GRCm39) D40E probably damaging Het
Tlr3 T C 8: 45,850,851 (GRCm39) H158R probably benign Het
Tppp2 G T 14: 52,156,392 (GRCm39) V50L probably benign Het
Trrap T C 5: 144,746,994 (GRCm39) S1503P probably benign Het
Ttll4 T G 1: 74,724,550 (GRCm39) S573R probably damaging Het
Vmn2r104 A T 17: 20,249,747 (GRCm39) N841K probably damaging Het
Vmn2r3 A T 3: 64,167,068 (GRCm39) C688S probably damaging Het
Vps16 T C 2: 130,266,369 (GRCm39) probably null Het
Zfp608 G A 18: 55,032,320 (GRCm39) T540I probably benign Het
Zfp775 G A 6: 48,596,750 (GRCm39) R208Q probably damaging Het
Other mutations in Ank2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01298:Ank2 APN 3 126,753,369 (GRCm39) missense possibly damaging 0.80
IGL01652:Ank2 APN 3 126,726,690 (GRCm39) missense probably benign 0.00
IGL01969:Ank2 APN 3 126,746,872 (GRCm39) missense possibly damaging 0.47
IGL02122:Ank2 APN 3 126,731,523 (GRCm39) splice site probably benign
IGL02537:Ank2 APN 3 126,749,565 (GRCm39) missense probably damaging 1.00
IGL02858:Ank2 APN 3 126,749,519 (GRCm39) missense probably damaging 1.00
IGL02981:Ank2 APN 3 126,728,211 (GRCm39) missense possibly damaging 0.58
IGL02981:Ank2 APN 3 126,749,519 (GRCm39) missense probably damaging 1.00
IGL03024:Ank2 APN 3 126,749,519 (GRCm39) missense probably damaging 1.00
IGL03074:Ank2 APN 3 126,749,519 (GRCm39) missense probably damaging 1.00
IGL03111:Ank2 APN 3 126,749,519 (GRCm39) missense probably damaging 1.00
IGL03129:Ank2 APN 3 126,749,519 (GRCm39) missense probably damaging 1.00
IGL03174:Ank2 APN 3 126,733,744 (GRCm39) missense probably damaging 0.98
IGL03177:Ank2 APN 3 126,749,519 (GRCm39) missense probably damaging 1.00
IGL03185:Ank2 APN 3 126,749,519 (GRCm39) missense probably damaging 1.00
IGL03188:Ank2 APN 3 126,749,519 (GRCm39) missense probably damaging 1.00
IGL03242:Ank2 APN 3 126,722,454 (GRCm39) missense possibly damaging 0.90
IGL03244:Ank2 APN 3 126,749,519 (GRCm39) missense probably damaging 1.00
IGL03248:Ank2 APN 3 126,749,519 (GRCm39) missense probably damaging 1.00
IGL03285:Ank2 APN 3 126,749,519 (GRCm39) missense probably damaging 1.00
IGL03304:Ank2 APN 3 126,749,519 (GRCm39) missense probably damaging 1.00
IGL03358:Ank2 APN 3 126,749,519 (GRCm39) missense probably damaging 1.00
IGL03380:Ank2 APN 3 126,749,519 (GRCm39) missense probably damaging 1.00
IGL03389:Ank2 APN 3 126,749,519 (GRCm39) missense probably damaging 1.00
IGL03400:Ank2 APN 3 126,749,519 (GRCm39) missense probably damaging 1.00
IGL03409:Ank2 APN 3 126,749,519 (GRCm39) missense probably damaging 1.00
ballast UTSW 3 126,736,782 (GRCm39) missense unknown
Chain UTSW 3 126,740,587 (GRCm39) intron probably benign
Deadman UTSW 3 126,723,471 (GRCm39) missense probably benign 0.19
drag UTSW 3 126,797,631 (GRCm39) missense probably damaging 1.00
mooring UTSW 3 126,728,226 (GRCm39) missense possibly damaging 0.73
Treasure UTSW 3 126,740,398 (GRCm39) missense unknown
Windlass UTSW 3 126,739,798 (GRCm39) missense probably benign
R0033:Ank2 UTSW 3 126,898,397 (GRCm39) splice site probably benign
R0042:Ank2 UTSW 3 126,730,280 (GRCm39) missense probably damaging 0.99
R0042:Ank2 UTSW 3 126,730,280 (GRCm39) missense probably damaging 0.99
R0079:Ank2 UTSW 3 126,728,264 (GRCm39) missense probably benign 0.01
R0423:Ank2 UTSW 3 126,723,509 (GRCm39) nonsense probably null
R0699:Ank2 UTSW 3 126,723,478 (GRCm39) missense probably benign 0.00
R0724:Ank2 UTSW 3 126,755,986 (GRCm39) missense probably damaging 1.00
R0990:Ank2 UTSW 3 126,728,315 (GRCm39) missense possibly damaging 0.64
R1450:Ank2 UTSW 3 126,750,951 (GRCm39) missense possibly damaging 0.94
R1500:Ank2 UTSW 3 126,726,631 (GRCm39) missense probably benign
R1702:Ank2 UTSW 3 126,749,548 (GRCm39) missense probably benign 0.00
R1703:Ank2 UTSW 3 126,723,415 (GRCm39) missense probably damaging 1.00
R1710:Ank2 UTSW 3 126,726,709 (GRCm39) nonsense probably null
R1743:Ank2 UTSW 3 126,722,324 (GRCm39) missense probably damaging 0.99
R1775:Ank2 UTSW 3 126,728,196 (GRCm39) missense probably benign 0.00
R1852:Ank2 UTSW 3 126,791,500 (GRCm39) critical splice donor site probably null
R2198:Ank2 UTSW 3 126,728,226 (GRCm39) missense possibly damaging 0.73
R2892:Ank2 UTSW 3 127,041,892 (GRCm39) splice site probably null
R2893:Ank2 UTSW 3 127,041,892 (GRCm39) splice site probably null
R2894:Ank2 UTSW 3 127,041,892 (GRCm39) splice site probably null
R3148:Ank2 UTSW 3 126,726,724 (GRCm39) missense probably benign 0.00
R3776:Ank2 UTSW 3 126,735,911 (GRCm39) intron probably benign
R3784:Ank2 UTSW 3 126,746,842 (GRCm39) missense probably damaging 1.00
R3856:Ank2 UTSW 3 126,723,493 (GRCm39) missense probably benign 0.00
R3906:Ank2 UTSW 3 126,810,547 (GRCm39) missense probably damaging 1.00
R3907:Ank2 UTSW 3 126,810,547 (GRCm39) missense probably damaging 1.00
R3953:Ank2 UTSW 3 126,781,809 (GRCm39) missense probably damaging 1.00
R3963:Ank2 UTSW 3 126,728,245 (GRCm39) missense probably benign
R4367:Ank2 UTSW 3 126,739,798 (GRCm39) missense probably benign
R4414:Ank2 UTSW 3 127,019,411 (GRCm39) critical splice donor site probably null
R4432:Ank2 UTSW 3 126,741,455 (GRCm39) intron probably benign
R4433:Ank2 UTSW 3 126,741,455 (GRCm39) intron probably benign
R4579:Ank2 UTSW 3 126,752,612 (GRCm39) missense probably damaging 1.00
R4597:Ank2 UTSW 3 126,781,800 (GRCm39) missense probably damaging 1.00
R4603:Ank2 UTSW 3 126,825,665 (GRCm39) missense probably benign 0.00
R4729:Ank2 UTSW 3 126,770,545 (GRCm39) nonsense probably null
R4815:Ank2 UTSW 3 126,730,410 (GRCm39) missense probably benign
R4826:Ank2 UTSW 3 126,749,650 (GRCm39) missense probably benign 0.35
R4871:Ank2 UTSW 3 126,753,444 (GRCm39) missense probably damaging 1.00
R4880:Ank2 UTSW 3 126,840,475 (GRCm39) splice site probably null
R4915:Ank2 UTSW 3 126,736,320 (GRCm39) intron probably benign
R4935:Ank2 UTSW 3 126,749,713 (GRCm39) missense probably damaging 1.00
R4936:Ank2 UTSW 3 126,748,688 (GRCm39) missense possibly damaging 0.94
R4937:Ank2 UTSW 3 126,756,050 (GRCm39) missense probably damaging 1.00
R4946:Ank2 UTSW 3 126,735,589 (GRCm39) intron probably benign
R4963:Ank2 UTSW 3 126,825,745 (GRCm39) missense probably benign 0.01
R4989:Ank2 UTSW 3 126,757,094 (GRCm39) missense possibly damaging 0.94
R5023:Ank2 UTSW 3 126,735,520 (GRCm39) intron probably benign
R5060:Ank2 UTSW 3 126,739,570 (GRCm39) intron probably benign
R5078:Ank2 UTSW 3 126,736,002 (GRCm39) intron probably benign
R5086:Ank2 UTSW 3 126,740,997 (GRCm39) intron probably benign
R5134:Ank2 UTSW 3 126,757,094 (GRCm39) missense possibly damaging 0.94
R5148:Ank2 UTSW 3 126,819,285 (GRCm39) splice site probably null
R5175:Ank2 UTSW 3 126,797,673 (GRCm39) missense probably damaging 1.00
R5275:Ank2 UTSW 3 126,825,832 (GRCm39) missense probably damaging 1.00
R5295:Ank2 UTSW 3 126,825,832 (GRCm39) missense probably damaging 1.00
R5303:Ank2 UTSW 3 126,739,453 (GRCm39) intron probably benign
R5309:Ank2 UTSW 3 126,753,417 (GRCm39) missense probably damaging 0.99
R5312:Ank2 UTSW 3 126,753,417 (GRCm39) missense probably damaging 0.99
R5352:Ank2 UTSW 3 127,292,640 (GRCm39) utr 5 prime probably benign
R5355:Ank2 UTSW 3 126,737,698 (GRCm39) intron probably benign
R5386:Ank2 UTSW 3 126,775,582 (GRCm39) missense probably benign 0.01
R5396:Ank2 UTSW 3 126,746,875 (GRCm39) missense probably damaging 1.00
R5518:Ank2 UTSW 3 126,753,348 (GRCm39) missense probably damaging 0.98
R5534:Ank2 UTSW 3 126,740,947 (GRCm39) intron probably benign
R5554:Ank2 UTSW 3 126,792,622 (GRCm39) missense possibly damaging 0.78
R5582:Ank2 UTSW 3 126,739,954 (GRCm39) intron probably benign
R5747:Ank2 UTSW 3 126,735,400 (GRCm39) intron probably benign
R5794:Ank2 UTSW 3 126,723,669 (GRCm39) missense probably benign 0.00
R5831:Ank2 UTSW 3 127,132,808 (GRCm39) start gained probably benign
R5925:Ank2 UTSW 3 126,726,612 (GRCm39) missense probably benign 0.18
R5954:Ank2 UTSW 3 126,791,510 (GRCm39) missense probably benign 0.34
R5956:Ank2 UTSW 3 126,736,337 (GRCm39) intron probably benign
R5986:Ank2 UTSW 3 126,806,335 (GRCm39) missense possibly damaging 0.94
R6020:Ank2 UTSW 3 126,740,470 (GRCm39) intron probably benign
R6027:Ank2 UTSW 3 126,791,528 (GRCm39) missense possibly damaging 0.92
R6049:Ank2 UTSW 3 126,736,669 (GRCm39) missense possibly damaging 0.95
R6060:Ank2 UTSW 3 126,749,601 (GRCm39) missense probably damaging 1.00
R6114:Ank2 UTSW 3 126,804,700 (GRCm39) missense probably damaging 1.00
R6124:Ank2 UTSW 3 127,041,800 (GRCm39) missense probably benign 0.31
R6156:Ank2 UTSW 3 126,737,886 (GRCm39) missense probably damaging 1.00
R6173:Ank2 UTSW 3 126,846,395 (GRCm39) missense probably damaging 1.00
R6176:Ank2 UTSW 3 126,739,120 (GRCm39) missense probably benign 0.05
R6184:Ank2 UTSW 3 126,756,047 (GRCm39) missense probably damaging 1.00
R6199:Ank2 UTSW 3 126,797,655 (GRCm39) missense probably damaging 1.00
R6241:Ank2 UTSW 3 126,846,397 (GRCm39) missense probably damaging 1.00
R6254:Ank2 UTSW 3 126,735,453 (GRCm39) intron probably benign
R6259:Ank2 UTSW 3 126,810,635 (GRCm39) missense probably benign 0.28
R6260:Ank2 UTSW 3 126,737,206 (GRCm39) missense probably benign
R6321:Ank2 UTSW 3 126,740,587 (GRCm39) intron probably benign
R6393:Ank2 UTSW 3 126,723,406 (GRCm39) missense probably damaging 1.00
R6406:Ank2 UTSW 3 126,825,874 (GRCm39) missense probably damaging 1.00
R6544:Ank2 UTSW 3 126,726,871 (GRCm39) missense probably damaging 0.99
R6583:Ank2 UTSW 3 126,810,613 (GRCm39) missense probably damaging 1.00
R6739:Ank2 UTSW 3 126,873,643 (GRCm39) missense probably damaging 1.00
R6754:Ank2 UTSW 3 126,890,488 (GRCm39) intron probably benign
R6786:Ank2 UTSW 3 126,752,581 (GRCm39) missense probably damaging 0.99
R6798:Ank2 UTSW 3 126,737,913 (GRCm39) intron probably benign
R6882:Ank2 UTSW 3 126,739,406 (GRCm39) intron probably benign
R6940:Ank2 UTSW 3 126,735,621 (GRCm39) intron probably benign
R6949:Ank2 UTSW 3 126,804,533 (GRCm39) missense probably benign 0.00
R7001:Ank2 UTSW 3 126,871,230 (GRCm39) missense probably damaging 1.00
R7033:Ank2 UTSW 3 126,738,499 (GRCm39) nonsense probably null
R7036:Ank2 UTSW 3 126,740,041 (GRCm39) intron probably benign
R7045:Ank2 UTSW 3 126,806,393 (GRCm39) missense probably damaging 1.00
R7048:Ank2 UTSW 3 126,819,267 (GRCm39) missense probably benign 0.03
R7054:Ank2 UTSW 3 126,736,952 (GRCm39) intron probably benign
R7069:Ank2 UTSW 3 126,739,947 (GRCm39) intron probably benign
R7091:Ank2 UTSW 3 126,817,000 (GRCm39) missense probably damaging 0.98
R7107:Ank2 UTSW 3 126,797,631 (GRCm39) missense probably damaging 1.00
R7175:Ank2 UTSW 3 126,740,590 (GRCm39) missense unknown
R7191:Ank2 UTSW 3 126,740,041 (GRCm39) missense unknown
R7272:Ank2 UTSW 3 126,736,782 (GRCm39) missense unknown
R7381:Ank2 UTSW 3 126,730,277 (GRCm39) missense possibly damaging 0.46
R7394:Ank2 UTSW 3 126,730,302 (GRCm39) missense possibly damaging 0.77
R7462:Ank2 UTSW 3 126,736,683 (GRCm39) missense unknown
R7490:Ank2 UTSW 3 126,752,538 (GRCm39) missense probably damaging 0.99
R7514:Ank2 UTSW 3 126,819,252 (GRCm39) missense probably benign 0.06
R7534:Ank2 UTSW 3 126,727,982 (GRCm39) splice site probably null
R7540:Ank2 UTSW 3 126,781,808 (GRCm39) missense possibly damaging 0.94
R7547:Ank2 UTSW 3 126,738,852 (GRCm39) missense unknown
R7579:Ank2 UTSW 3 126,740,047 (GRCm39) missense unknown
R7584:Ank2 UTSW 3 126,739,777 (GRCm39) nonsense probably null
R7625:Ank2 UTSW 3 126,846,449 (GRCm39) missense probably damaging 1.00
R7698:Ank2 UTSW 3 126,825,860 (GRCm39) missense probably benign 0.35
R7716:Ank2 UTSW 3 126,736,815 (GRCm39) missense unknown
R7718:Ank2 UTSW 3 126,758,662 (GRCm39) missense possibly damaging 0.88
R7722:Ank2 UTSW 3 126,822,951 (GRCm39) missense probably benign 0.01
R7738:Ank2 UTSW 3 126,741,271 (GRCm39) missense
R7977:Ank2 UTSW 3 126,739,356 (GRCm39) missense unknown
R7987:Ank2 UTSW 3 126,739,356 (GRCm39) missense unknown
R8007:Ank2 UTSW 3 126,730,096 (GRCm39) intron probably benign
R8150:Ank2 UTSW 3 126,741,162 (GRCm39) missense
R8161:Ank2 UTSW 3 126,825,778 (GRCm39) missense
R8196:Ank2 UTSW 3 126,723,532 (GRCm39) missense probably damaging 0.99
R8248:Ank2 UTSW 3 126,731,434 (GRCm39) missense possibly damaging 0.78
R8255:Ank2 UTSW 3 126,740,398 (GRCm39) missense unknown
R8279:Ank2 UTSW 3 126,726,820 (GRCm39) missense probably benign 0.04
R8300:Ank2 UTSW 3 126,804,555 (GRCm39) missense
R8716:Ank2 UTSW 3 126,736,488 (GRCm39) nonsense probably null
R8724:Ank2 UTSW 3 126,737,405 (GRCm39) missense unknown
R8765:Ank2 UTSW 3 126,850,731 (GRCm39) missense possibly damaging 0.94
R8779:Ank2 UTSW 3 126,758,751 (GRCm39) missense probably damaging 0.99
R8783:Ank2 UTSW 3 126,846,455 (GRCm39) missense probably damaging 1.00
R8785:Ank2 UTSW 3 126,791,570 (GRCm39) missense probably damaging 1.00
R8826:Ank2 UTSW 3 126,740,951 (GRCm39) missense unknown
R8872:Ank2 UTSW 3 126,791,525 (GRCm39) missense possibly damaging 0.88
R8903:Ank2 UTSW 3 126,840,431 (GRCm39) missense probably damaging 1.00
R8906:Ank2 UTSW 3 126,726,720 (GRCm39) missense probably benign 0.00
R8918:Ank2 UTSW 3 126,737,380 (GRCm39) missense unknown
R8947:Ank2 UTSW 3 126,736,396 (GRCm39) intron probably benign
R8977:Ank2 UTSW 3 126,738,575 (GRCm39) missense unknown
R8990:Ank2 UTSW 3 126,841,829 (GRCm39) critical splice donor site probably null
R8994:Ank2 UTSW 3 126,723,471 (GRCm39) missense probably benign 0.19
R9009:Ank2 UTSW 3 126,728,025 (GRCm39) unclassified probably benign
R9123:Ank2 UTSW 3 126,733,744 (GRCm39) missense probably damaging 1.00
R9125:Ank2 UTSW 3 126,733,744 (GRCm39) missense probably damaging 1.00
R9130:Ank2 UTSW 3 126,810,565 (GRCm39) missense
R9175:Ank2 UTSW 3 126,722,402 (GRCm39) missense possibly damaging 0.52
R9220:Ank2 UTSW 3 126,737,086 (GRCm39) missense unknown
R9225:Ank2 UTSW 3 126,736,111 (GRCm39) missense unknown
R9286:Ank2 UTSW 3 126,846,381 (GRCm39) missense probably damaging 0.99
R9325:Ank2 UTSW 3 126,775,504 (GRCm39) missense probably damaging 0.98
R9367:Ank2 UTSW 3 126,738,678 (GRCm39) missense unknown
R9385:Ank2 UTSW 3 126,753,366 (GRCm39) missense probably benign 0.00
R9391:Ank2 UTSW 3 126,731,394 (GRCm39) missense probably damaging 0.99
R9422:Ank2 UTSW 3 126,890,505 (GRCm39) missense unknown
R9536:Ank2 UTSW 3 126,736,031 (GRCm39) missense unknown
R9647:Ank2 UTSW 3 126,792,623 (GRCm39) missense possibly damaging 0.93
R9650:Ank2 UTSW 3 126,735,829 (GRCm39) missense unknown
R9666:Ank2 UTSW 3 126,726,838 (GRCm39) nonsense probably null
R9686:Ank2 UTSW 3 126,740,550 (GRCm39) missense unknown
R9730:Ank2 UTSW 3 127,019,493 (GRCm39) missense
R9738:Ank2 UTSW 3 126,737,121 (GRCm39) missense unknown
R9743:Ank2 UTSW 3 126,733,794 (GRCm39) missense possibly damaging 0.81
R9747:Ank2 UTSW 3 126,752,667 (GRCm39) missense probably damaging 1.00
R9800:Ank2 UTSW 3 126,740,149 (GRCm39) missense unknown
R9803:Ank2 UTSW 3 126,752,726 (GRCm39) missense possibly damaging 0.64
RF020:Ank2 UTSW 3 126,739,125 (GRCm39) missense unknown
Z1088:Ank2 UTSW 3 126,823,158 (GRCm39) missense possibly damaging 0.45
Z1177:Ank2 UTSW 3 126,738,006 (GRCm39) missense unknown
Z1187:Ank2 UTSW 3 126,749,601 (GRCm39) missense probably damaging 1.00
Z1190:Ank2 UTSW 3 126,749,601 (GRCm39) missense probably damaging 1.00
Z1192:Ank2 UTSW 3 126,749,601 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGCAGCTGTAAGATTAGTAC -3'
(R):5'- AATCTGCCGCATCATCACTCG -3'

Sequencing Primer
(F):5'- GACAACCTGAGGAAGTTCTCATCTTC -3'
(R):5'- GTGACTTCCCACAGTACTTTGCG -3'
Posted On 2017-06-26