Incidental Mutation 'R5992:Mob3b'
ID480873
Institutional Source Beutler Lab
Gene Symbol Mob3b
Ensembl Gene ENSMUSG00000073910
Gene NameMOB kinase activator 3B
SynonymsA430018A01Rik, MOB3B, 8430436F23Rik, Mobkl2b
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R5992 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location34949074-35157484 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35084069 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 40 (S40L)
Ref Sequence ENSEMBL: ENSMUSP00000100040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102975]
Predicted Effect probably benign
Transcript: ENSMUST00000102975
AA Change: S40L

PolyPhen 2 Score 0.429 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000100040
Gene: ENSMUSG00000073910
AA Change: S40L

DomainStartEndE-ValueType
Mob1_phocein 33 207 1.93e-105 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155725
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with the yeast Mob1 protein. Yeast Mob1 binds Mps1p, a protein kinase essential for spindle pole body duplication and mitotic checkpoint regulation. This gene is located on the opposite strand as the interferon kappa precursor (IFNK) gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,508,623 L188* probably null Het
Acod1 C T 14: 103,055,035 R332C probably damaging Het
Adamts3 T A 5: 89,691,335 K852M probably damaging Het
Adm A T 7: 110,627,696 probably benign Het
Aff4 A G 11: 53,373,010 S286G probably damaging Het
Ank2 A G 3: 126,959,651 probably null Het
Aqr A T 2: 114,143,049 Y427* probably null Het
Arid1b C A 17: 4,994,956 probably benign Het
Arpp21 T A 9: 112,143,485 R259* probably null Het
Cep290 C T 10: 100,543,321 A55V possibly damaging Het
Chsy3 GT G 18: 59,176,166 probably null Het
Clcn2 T C 16: 20,713,654 E68G possibly damaging Het
Corin T A 5: 72,316,389 H699L probably benign Het
Cyld T C 8: 88,733,053 Y446H probably damaging Het
Dcst1 T A 3: 89,352,576 E613V probably damaging Het
Dlk1 T C 12: 109,455,581 C74R probably damaging Het
Dnah12 A C 14: 26,697,341 K128T probably benign Het
Dspp T A 5: 104,178,451 S893R unknown Het
Dtl A T 1: 191,568,572 probably null Het
F2rl1 T A 13: 95,514,270 S35C probably benign Het
Fcgbp A T 7: 28,120,534 Y2562F probably benign Het
Fgf10 A T 13: 118,715,508 D42V probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm21190 T A 5: 15,524,851 E256D probably damaging Het
Gm5157 A G 7: 21,185,421 S66P probably damaging Het
Gm884 A T 11: 103,613,792 M2450K possibly damaging Het
Hal T G 10: 93,490,916 L138R probably damaging Het
Hsd17b3 T C 13: 64,059,470 probably null Het
Lrsam1 T C 2: 32,955,222 T94A probably benign Het
Macc1 T C 12: 119,447,585 V696A probably damaging Het
Magi2 G A 5: 19,227,291 M1I probably null Het
March7 C A 2: 60,245,220 N674K probably benign Het
Mfap1b A G 2: 121,470,295 V34A probably benign Het
Ndufs2 A T 1: 171,236,418 V386E probably damaging Het
Nfic C T 10: 81,420,747 A19T probably damaging Het
Nfs1 G A 2: 156,134,453 R174W probably damaging Het
Nin G T 12: 70,045,524 S670R possibly damaging Het
Nrxn1 T C 17: 90,623,507 I754V probably benign Het
Nwd1 T C 8: 72,653,573 probably null Het
Olfr1231 T A 2: 89,303,359 T78S possibly damaging Het
Olfr1238 T A 2: 89,406,879 M67L probably benign Het
Olfr575 G T 7: 102,955,009 N197K probably benign Het
Pcdhgb8 A G 18: 37,763,449 E524G probably damaging Het
Phlpp1 A T 1: 106,318,993 R638* probably null Het
Pkmyt1 G C 17: 23,735,326 W360S probably benign Het
Plxnd1 C A 6: 115,967,787 probably null Het
Poldip3 A T 15: 83,129,229 N322K probably damaging Het
Prmt3 A T 7: 49,828,947 I419L probably benign Het
Prss36 A T 7: 127,944,830 V123E probably damaging Het
Prss58 A G 6: 40,897,769 I46T probably damaging Het
Rac1 T C 5: 143,506,998 probably benign Het
Rb1cc1 A G 1: 6,233,996 Y36C probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rp1 A T 1: 4,148,703 F951L unknown Het
Rps6ka5 G T 12: 100,575,250 P417T possibly damaging Het
Ryr1 A G 7: 29,067,637 W2967R probably damaging Het
Sacs T A 14: 61,205,543 S1679R probably damaging Het
Scn1a A C 2: 66,335,456 W153G probably damaging Het
Serpinb7 A G 1: 107,445,996 Y114C probably damaging Het
Son T C 16: 91,658,904 M1513T probably benign Het
Spag8 C T 4: 43,651,534 V447M probably benign Het
St3gal2 T A 8: 110,969,553 Y257N probably damaging Het
Tars A T 15: 11,397,196 D40E probably damaging Het
Tlr3 T C 8: 45,397,814 H158R probably benign Het
Tppp2 G T 14: 51,918,935 V50L probably benign Het
Trrap T C 5: 144,810,184 S1503P probably benign Het
Ttll4 T G 1: 74,685,391 S573R probably damaging Het
Vmn2r104 A T 17: 20,029,485 N841K probably damaging Het
Vmn2r3 A T 3: 64,259,647 C688S probably damaging Het
Vps16 T C 2: 130,424,449 probably null Het
Zfp608 G A 18: 54,899,248 T540I probably benign Het
Zfp775 G A 6: 48,619,816 R208Q probably damaging Het
Other mutations in Mob3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02198:Mob3b APN 4 35083983 missense probably damaging 1.00
IGL02991:Mob3b UTSW 4 35083805 missense probably benign 0.01
R0016:Mob3b UTSW 4 35083947 missense probably benign 0.02
R0408:Mob3b UTSW 4 35083991 missense probably damaging 1.00
R1542:Mob3b UTSW 4 35084046 missense possibly damaging 0.88
R1686:Mob3b UTSW 4 34985910 splice site probably benign
R1723:Mob3b UTSW 4 34954026 missense probably damaging 0.99
R1726:Mob3b UTSW 4 34954028 missense probably benign 0.09
R2013:Mob3b UTSW 4 35083922 missense probably benign 0.00
R2112:Mob3b UTSW 4 35083795 missense probably damaging 0.97
R6043:Mob3b UTSW 4 34985993 missense probably benign 0.05
R6418:Mob3b UTSW 4 34954049 critical splice acceptor site probably null
R7117:Mob3b UTSW 4 34985914 critical splice donor site probably null
R7170:Mob3b UTSW 4 35083839 missense probably damaging 1.00
R7714:Mob3b UTSW 4 35083872 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGATTCATGTACTGGGGAG -3'
(R):5'- TCACTCCAAAGTCCCAAGTG -3'

Sequencing Primer
(F):5'- AGGTCATCCTGCCATCGGTAC -3'
(R):5'- AAAGTCCCAAGTGCCTTTTTG -3'
Posted On2017-06-26