Mutagenetix > Incidental Mutations

Incidental Mutation 'R5992:Dspp'

480879

Institutional Source

Beutler Lab

Gene Symbol

Dspp

Ensembl Gene

ENSMUSG00000053268

Gene Name

dentin sialophosphoprotein

Synonyms

Dmp3, Dsp, Dpp

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5992 (G1)

Quality Score

155.008

Status

Not validated

Chromosome

Chromosomal Location

104170712-104180127 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 104178451 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 893 (S893R)

Ref Sequence

ENSEMBL: ENSMUSP00000108391 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112771]

Predicted Effect

unknown
Transcript: ENSMUST00000112771
AA Change: S893R

SMART Domains

Protein: ENSMUSP00000108391
Gene: ENSMUSG00000053268
AA Change: S893R

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
low complexity region	52	67	N/A	INTRINSIC
internal_repeat_1	82	245	2.01e-11	PROSPERO
low complexity region	247	268	N/A	INTRINSIC
low complexity region	271	282	N/A	INTRINSIC
internal_repeat_1	285	438	2.01e-11	PROSPERO
internal_repeat_2	286	369	2.15e-10	PROSPERO
internal_repeat_2	370	454	2.15e-10	PROSPERO
low complexity region	456	472	N/A	INTRINSIC
low complexity region	481	944	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 91.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the small integrin-binding ligand N-linked glycoprotein (SIBLING) family of proteins. The encoded preproprotein is secreted by odontoblasts and proteolytically processed to generate two principal proteins of the dentin extracellular matrix of the tooth, dentin sialoprotein and dentin phosphoprotein. These two protein products may play distinct but related roles in dentin mineralization. Mice lacking the encoded protein exhibit hypomineralization defects in dentin, similar to human dentinogenesis imperfecta. [provided by RefSeq, Feb 2016]
PHENOTYPE: Aging mice homozygous for a reporter/null allele display tooth abnormalities, including enlarged pulp cavities, a widened predentin zone, dentin hypomineralization, pulp exposure, and occasional brittle incisors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars2	T	A	17: 45,508,623	L188*	probably null	Het
Acod1	C	T	14: 103,055,035	R332C	probably damaging	Het
Adamts3	T	A	5: 89,691,335	K852M	probably damaging	Het
Adm	A	T	7: 110,627,696		probably benign	Het
Aff4	A	G	11: 53,373,010	S286G	probably damaging	Het
Ank2	A	G	3: 126,959,651		probably null	Het
Aqr	A	T	2: 114,143,049	Y427*	probably null	Het
Arid1b	C	A	17: 4,994,956		probably benign	Het
Arpp21	T	A	9: 112,143,485	R259*	probably null	Het
Cep290	C	T	10: 100,543,321	A55V	possibly damaging	Het
Chsy3	GT	G	18: 59,176,166		probably null	Het
Clcn2	T	C	16: 20,713,654	E68G	possibly damaging	Het
Corin	T	A	5: 72,316,389	H699L	probably benign	Het
Cyld	T	C	8: 88,733,053	Y446H	probably damaging	Het
Dcst1	T	A	3: 89,352,576	E613V	probably damaging	Het
Dlk1	T	C	12: 109,455,581	C74R	probably damaging	Het
Dnah12	A	C	14: 26,697,341	K128T	probably benign	Het
Dtl	A	T	1: 191,568,572		probably null	Het
F2rl1	T	A	13: 95,514,270	S35C	probably benign	Het
Fcgbp	A	T	7: 28,120,534	Y2562F	probably benign	Het
Fgf10	A	T	13: 118,715,508	D42V	probably benign	Het
Gm10271	A	T	10: 116,972,592	F6L	probably damaging	Het
Gm21190	T	A	5: 15,524,851	E256D	probably damaging	Het
Gm5157	A	G	7: 21,185,421	S66P	probably damaging	Het
Gm884	A	T	11: 103,613,792	M2450K	possibly damaging	Het
Hal	T	G	10: 93,490,916	L138R	probably damaging	Het
Hsd17b3	T	C	13: 64,059,470		probably null	Het
Lrsam1	T	C	2: 32,955,222	T94A	probably benign	Het
Macc1	T	C	12: 119,447,585	V696A	probably damaging	Het
Magi2	G	A	5: 19,227,291	M1I	probably null	Het
March7	C	A	2: 60,245,220	N674K	probably benign	Het
Mfap1b	A	G	2: 121,470,295	V34A	probably benign	Het
Mob3b	G	A	4: 35,084,069	S40L	probably benign	Het
Ndufs2	A	T	1: 171,236,418	V386E	probably damaging	Het
Nfic	C	T	10: 81,420,747	A19T	probably damaging	Het
Nfs1	G	A	2: 156,134,453	R174W	probably damaging	Het
Nin	G	T	12: 70,045,524	S670R	possibly damaging	Het
Nrxn1	T	C	17: 90,623,507	I754V	probably benign	Het
Nwd1	T	C	8: 72,653,573		probably null	Het
Olfr1231	T	A	2: 89,303,359	T78S	possibly damaging	Het
Olfr1238	T	A	2: 89,406,879	M67L	probably benign	Het
Olfr575	G	T	7: 102,955,009	N197K	probably benign	Het
Pcdhgb8	A	G	18: 37,763,449	E524G	probably damaging	Het
Phlpp1	A	T	1: 106,318,993	R638*	probably null	Het
Pkmyt1	G	C	17: 23,735,326	W360S	probably benign	Het
Plxnd1	C	A	6: 115,967,787		probably null	Het
Poldip3	A	T	15: 83,129,229	N322K	probably damaging	Het
Prmt3	A	T	7: 49,828,947	I419L	probably benign	Het
Prss36	A	T	7: 127,944,830	V123E	probably damaging	Het
Prss58	A	G	6: 40,897,769	I46T	probably damaging	Het
Rac1	T	C	5: 143,506,998		probably benign	Het
Rb1cc1	A	G	1: 6,233,996	Y36C	probably damaging	Het
Rif1	C	G	2: 52,095,844	L614V	probably damaging	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Rp1	A	T	1: 4,148,703	F951L	unknown	Het
Rps6ka5	G	T	12: 100,575,250	P417T	possibly damaging	Het
Ryr1	A	G	7: 29,067,637	W2967R	probably damaging	Het
Sacs	T	A	14: 61,205,543	S1679R	probably damaging	Het
Scn1a	A	C	2: 66,335,456	W153G	probably damaging	Het
Serpinb7	A	G	1: 107,445,996	Y114C	probably damaging	Het
Son	T	C	16: 91,658,904	M1513T	probably benign	Het
Spag8	C	T	4: 43,651,534	V447M	probably benign	Het
St3gal2	T	A	8: 110,969,553	Y257N	probably damaging	Het
Tars	A	T	15: 11,397,196	D40E	probably damaging	Het
Tlr3	T	C	8: 45,397,814	H158R	probably benign	Het
Tppp2	G	T	14: 51,918,935	V50L	probably benign	Het
Trrap	T	C	5: 144,810,184	S1503P	probably benign	Het
Ttll4	T	G	1: 74,685,391	S573R	probably damaging	Het
Vmn2r104	A	T	17: 20,029,485	N841K	probably damaging	Het
Vmn2r3	A	T	3: 64,259,647	C688S	probably damaging	Het
Vps16	T	C	2: 130,424,449		probably null	Het
Zfp608	G	A	18: 54,899,248	T540I	probably benign	Het
Zfp775	G	A	6: 48,619,816	R208Q	probably damaging	Het

Other mutations in Dspp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00973:Dspp	APN	5	104176892	missense	possibly damaging	0.95
IGL01096:Dspp	APN	5	104175367	missense	possibly damaging	0.92
IGL01317:Dspp	APN	5	104174048	missense	probably damaging	0.99
IGL02365:Dspp	APN	5	104176061	missense	probably damaging	1.00
IGL02387:Dspp	APN	5	104175624	missense	possibly damaging	0.82
IGL02406:Dspp	APN	5	104177366	nonsense	probably null
IGL02445:Dspp	APN	5	104177097	missense	probably damaging	0.99
IGL02481:Dspp	APN	5	104175648	missense	possibly damaging	0.94
IGL02536:Dspp	APN	5	104175665	missense	probably damaging	0.99
IGL02572:Dspp	APN	5	104177069	missense	probably damaging	0.99
IGL02677:Dspp	APN	5	104175977	missense	possibly damaging	0.78
IGL02709:Dspp	APN	5	104177250	missense	unknown
IGL02723:Dspp	APN	5	104175175	missense	probably benign	0.03
IGL02740:Dspp	APN	5	104177238	nonsense	probably null
IGL03274:Dspp	APN	5	104174948	missense	probably damaging	0.99
IGL03293:Dspp	APN	5	104177561	missense	unknown
FR4449:Dspp	UTSW	5	104178388	small deletion	probably benign
R0018:Dspp	UTSW	5	104178230	missense	unknown
R0125:Dspp	UTSW	5	104178039	missense	unknown
R0503:Dspp	UTSW	5	104177256	missense	unknown
R1709:Dspp	UTSW	5	104175724	missense	probably damaging	0.98
R1851:Dspp	UTSW	5	104174085	critical splice donor site	probably null
R2001:Dspp	UTSW	5	104178559	missense	unknown
R2002:Dspp	UTSW	5	104178559	missense	unknown
R2198:Dspp	UTSW	5	104175701	missense	probably benign	0.37
R2279:Dspp	UTSW	5	104178384	missense	unknown
R4026:Dspp	UTSW	5	104177697	missense	unknown
R4066:Dspp	UTSW	5	104177194	missense	unknown
R4632:Dspp	UTSW	5	104177406	missense	unknown
R4693:Dspp	UTSW	5	104178062	missense	unknown
R4841:Dspp	UTSW	5	104177186	missense	unknown
R4841:Dspp	UTSW	5	104177187	missense	unknown
R4917:Dspp	UTSW	5	104177923	missense	unknown
R5008:Dspp	UTSW	5	104175573	missense	possibly damaging	0.66
R5015:Dspp	UTSW	5	104177060	missense	possibly damaging	0.46
R5214:Dspp	UTSW	5	104178498	missense	unknown
R5359:Dspp	UTSW	5	104175886	missense	probably damaging	0.98
R5538:Dspp	UTSW	5	104175230	nonsense	probably null
R5703:Dspp	UTSW	5	104177051	missense	possibly damaging	0.82
R5887:Dspp	UTSW	5	104175455	missense	probably damaging	1.00
R5902:Dspp	UTSW	5	104178111	missense	unknown
R6019:Dspp	UTSW	5	104178039	missense	unknown
R6191:Dspp	UTSW	5	104177348	missense	unknown
R6362:Dspp	UTSW	5	104176034	missense	probably benign	0.19
R6736:Dspp	UTSW	5	104178175	missense	unknown
R6805:Dspp	UTSW	5	104175850	missense	probably benign	0.03
R7064:Dspp	UTSW	5	104176938	missense	possibly damaging	0.73
R7178:Dspp	UTSW	5	104174066	missense	probably benign	0.02
R7243:Dspp	UTSW	5	104178361	small deletion	probably benign
R7390:Dspp	UTSW	5	104175686	missense	probably damaging	0.98
R7454:Dspp	UTSW	5	104175610	missense	probably benign	0.01
R7585:Dspp	UTSW	5	104175525	missense	possibly damaging	0.90
R7662:Dspp	UTSW	5	104177870	missense	unknown
R7739:Dspp	UTSW	5	104178146	missense	unknown
R7755:Dspp	UTSW	5	104178361	small deletion	probably benign
R7805:Dspp	UTSW	5	104175393	missense	probably damaging	0.99
R7869:Dspp	UTSW	5	104175665	missense	probably damaging	0.99
R7952:Dspp	UTSW	5	104175665	missense	probably damaging	0.99
RF007:Dspp	UTSW	5	104178361	small deletion	probably benign
RF044:Dspp	UTSW	5	104178424	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- GCAGCAACAGTAGTGACAGC -3'
(R):5'- GGATATCATGGGTTCTCTCTGATC -3'

Sequencing Primer
(F):5'- CAGCAGTGACAGTAGCGAC -3'
(R):5'- CTGATCTAATCATCACTGGTTGAGTG -3'

Posted On

2017-06-26