Mutagenetix > Incidental Mutation

Incidental Mutation 'R5992:Trrap'

480881

Institutional Source

Beutler Lab

Gene Symbol

Trrap

Ensembl Gene

ENSMUSG00000045482

Gene Name

transformation/transcription domain-associated protein

Synonyms

transactivation/transformation-domain associated protein

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5992 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

144767732-144859778 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 144810184 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1503 (S1503P)

Ref Sequence

ENSEMBL: ENSMUSP00000091668 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038980] [ENSMUST00000094120] [ENSMUST00000100467] [ENSMUST00000213013]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000038980

SMART Domains

Protein: ENSMUSP00000042544
Gene: ENSMUSG00000045482

Domain	Start	End	E-Value	Type
low complexity region	482	527	N/A	INTRINSIC
low complexity region	529	540	N/A	INTRINSIC
Blast:PI3Kc	765	864	1e-13	BLAST
SCOP:d1gw5a_	1184	1664	2e-6	SMART
low complexity region	1832	1843	N/A	INTRINSIC
low complexity region	1866	1881	N/A	INTRINSIC
low complexity region	2289	2303	N/A	INTRINSIC
Pfam:FAT	2830	3174	4.7e-69	PFAM
low complexity region	3363	3376	N/A	INTRINSIC
low complexity region	3407	3418	N/A	INTRINSIC
PI3Kc	3509	3798	5.11e-8	SMART
FATC	3797	3829	1.89e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000094120
AA Change: S1503P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000091668
Gene: ENSMUSG00000045482
AA Change: S1503P

Domain	Start	End	E-Value	Type
low complexity region	482	527	N/A	INTRINSIC
low complexity region	529	540	N/A	INTRINSIC
Blast:PI3Kc	765	864	1e-13	BLAST
SCOP:d1gw5a_	1184	1682	2e-6	SMART
low complexity region	1850	1861	N/A	INTRINSIC
low complexity region	1884	1899	N/A	INTRINSIC
low complexity region	2307	2321	N/A	INTRINSIC
Pfam:FAT	2848	3203	1.1e-68	PFAM
low complexity region	3392	3405	N/A	INTRINSIC
low complexity region	3436	3447	N/A	INTRINSIC
PI3Kc	3538	3827	5.11e-8	SMART
FATC	3826	3858	1.89e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000100467

SMART Domains

Protein: ENSMUSP00000098035
Gene: ENSMUSG00000045482

Domain	Start	End	E-Value	Type
low complexity region	482	527	N/A	INTRINSIC
low complexity region	529	540	N/A	INTRINSIC
Blast:PI3Kc	765	864	1e-13	BLAST
SCOP:d1gw5a_	1184	1664	2e-6	SMART
low complexity region	1832	1843	N/A	INTRINSIC
low complexity region	1866	1881	N/A	INTRINSIC
low complexity region	2289	2303	N/A	INTRINSIC
Pfam:FAT	2830	3174	4.7e-69	PFAM
low complexity region	3381	3394	N/A	INTRINSIC
low complexity region	3425	3436	N/A	INTRINSIC
PI3Kc	3527	3816	5.11e-8	SMART
FATC	3815	3847	1.89e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132347

Predicted Effect

unknown
Transcript: ENSMUST00000132925
AA Change: S1217P

SMART Domains

Protein: ENSMUSP00000122021
Gene: ENSMUSG00000045482
AA Change: S1217P

Domain	Start	End	E-Value	Type
low complexity region	197	242	N/A	INTRINSIC
low complexity region	244	255	N/A	INTRINSIC
SCOP:d1gw5a_	474	1003	9e-7	SMART
Blast:PI3Kc	480	579	1e-13	BLAST
low complexity region	1083	1092	N/A	INTRINSIC
low complexity region	1572	1583	N/A	INTRINSIC
low complexity region	1606	1621	N/A	INTRINSIC
low complexity region	2029	2043	N/A	INTRINSIC
Pfam:FAT	2570	2914	1.5e-69	PFAM
low complexity region	3121	3134	N/A	INTRINSIC
low complexity region	3165	3176	N/A	INTRINSIC
PI3Kc	3267	3556	5.11e-8	SMART
FATC	3555	3587	1.89e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197834

Predicted Effect

probably benign
Transcript: ENSMUST00000213013
AA Change: S1504P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 91.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large multidomain protein of the phosphoinositide 3-kinase-related kinases (PIKK) family. The encoded protein is a common component of many histone acetyltransferase (HAT) complexes and plays a role in transcription and DNA repair by recruiting HAT complexes to chromatin. Deregulation of this gene may play a role in several types of cancer including glioblastoma multiforme. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous embryos die prior to E3.5 and exhibit embryonic and extraembryonic tissue disorganization. Mitotic abnormalities were also noted in homozygous cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars2	T	A	17: 45,508,623 (GRCm38)	L188*	probably null	Het
Acod1	C	T	14: 103,055,035 (GRCm38)	R332C	probably damaging	Het
Adamts3	T	A	5: 89,691,335 (GRCm38)	K852M	probably damaging	Het
Adm	A	T	7: 110,627,696 (GRCm38)		probably benign	Het
Aff4	A	G	11: 53,373,010 (GRCm38)	S286G	probably damaging	Het
Ank2	A	G	3: 126,959,651 (GRCm38)		probably null	Het
Aqr	A	T	2: 114,143,049 (GRCm38)	Y427*	probably null	Het
Arid1b	C	A	17: 4,994,956 (GRCm38)		probably benign	Het
Arpp21	T	A	9: 112,143,485 (GRCm38)	R259*	probably null	Het
Cep290	C	T	10: 100,543,321 (GRCm38)	A55V	possibly damaging	Het
Chsy3	GT	G	18: 59,176,166 (GRCm38)	163	probably null	Het
Clcn2	T	C	16: 20,713,654 (GRCm38)	E68G	possibly damaging	Het
Corin	T	A	5: 72,316,389 (GRCm38)	H699L	probably benign	Het
Cyld	T	C	8: 88,733,053 (GRCm38)	Y446H	probably damaging	Het
Dcst1	T	A	3: 89,352,576 (GRCm38)	E613V	probably damaging	Het
Dlk1	T	C	12: 109,455,581 (GRCm38)	C74R	probably damaging	Het
Dnah12	A	C	14: 26,697,341 (GRCm38)	K128T	probably benign	Het
Dspp	T	A	5: 104,178,451 (GRCm38)	S893R	unknown	Het
Dtl	A	T	1: 191,568,572 (GRCm38)		probably null	Het
F2rl1	T	A	13: 95,514,270 (GRCm38)	S35C	probably benign	Het
Fcgbp	A	T	7: 28,120,534 (GRCm38)	Y2562F	probably benign	Het
Fgf10	A	T	13: 118,715,508 (GRCm38)	D42V	probably benign	Het
Gm10271	A	T	10: 116,972,592 (GRCm38)	F6L	probably damaging	Het
Gm21190	T	A	5: 15,524,851 (GRCm38)	E256D	probably damaging	Het
Gm5157	A	G	7: 21,185,421 (GRCm38)	S66P	probably damaging	Het
Hal	T	G	10: 93,490,916 (GRCm38)	L138R	probably damaging	Het
Hsd17b3	T	C	13: 64,059,470 (GRCm38)		probably null	Het
Lrrc37	A	T	11: 103,613,792 (GRCm38)	M2450K	possibly damaging	Het
Lrsam1	T	C	2: 32,955,222 (GRCm38)	T94A	probably benign	Het
Macc1	T	C	12: 119,447,585 (GRCm38)	V696A	probably damaging	Het
Magi2	G	A	5: 19,227,291 (GRCm38)	M1I	probably null	Het
Marchf7	C	A	2: 60,245,220 (GRCm38)	N674K	probably benign	Het
Mfap1b	A	G	2: 121,470,295 (GRCm38)	V34A	probably benign	Het
Mob3b	G	A	4: 35,084,069 (GRCm38)	S40L	probably benign	Het
Ndufs2	A	T	1: 171,236,418 (GRCm38)	V386E	probably damaging	Het
Nfic	C	T	10: 81,420,747 (GRCm38)	A19T	probably damaging	Het
Nfs1	G	A	2: 156,134,453 (GRCm38)	R174W	probably damaging	Het
Nin	G	T	12: 70,045,524 (GRCm38)	S670R	possibly damaging	Het
Nrxn1	T	C	17: 90,623,507 (GRCm38)	I754V	probably benign	Het
Nwd1	T	C	8: 72,653,573 (GRCm38)		probably null	Het
Or4a39	T	A	2: 89,406,879 (GRCm38)	M67L	probably benign	Het
Or4c1	T	A	2: 89,303,359 (GRCm38)	T78S	possibly damaging	Het
Or51a6	G	T	7: 102,955,009 (GRCm38)	N197K	probably benign	Het
Pcdhgb8	A	G	18: 37,763,449 (GRCm38)	E524G	probably damaging	Het
Phlpp1	A	T	1: 106,318,993 (GRCm38)	R638*	probably null	Het
Pkmyt1	G	C	17: 23,735,326 (GRCm38)	W360S	probably benign	Het
Plxnd1	C	A	6: 115,967,787 (GRCm38)		probably null	Het
Poldip3	A	T	15: 83,129,229 (GRCm38)	N322K	probably damaging	Het
Prmt3	A	T	7: 49,828,947 (GRCm38)	I419L	probably benign	Het
Prss36	A	T	7: 127,944,830 (GRCm38)	V123E	probably damaging	Het
Prss58	A	G	6: 40,897,769 (GRCm38)	I46T	probably damaging	Het
Rac1	T	C	5: 143,506,998 (GRCm38)		probably benign	Het
Rb1cc1	A	G	1: 6,233,996 (GRCm38)	Y36C	probably damaging	Het
Rif1	C	G	2: 52,095,844 (GRCm38)	L614V	probably damaging	Het
Rnd2	C	T	11: 101,468,999 (GRCm38)	L57F	probably damaging	Het
Rp1	A	T	1: 4,148,703 (GRCm38)	F951L	unknown	Het
Rps6ka5	G	T	12: 100,575,250 (GRCm38)	P417T	possibly damaging	Het
Ryr1	A	G	7: 29,067,637 (GRCm38)	W2967R	probably damaging	Het
Sacs	T	A	14: 61,205,543 (GRCm38)	S1679R	probably damaging	Het
Scn1a	A	C	2: 66,335,456 (GRCm38)	W153G	probably damaging	Het
Serpinb7	A	G	1: 107,445,996 (GRCm38)	Y114C	probably damaging	Het
Son	T	C	16: 91,658,904 (GRCm38)	M1513T	probably benign	Het
Spag8	C	T	4: 43,651,534 (GRCm38)	V447M	probably benign	Het
St3gal2	T	A	8: 110,969,553 (GRCm38)	Y257N	probably damaging	Het
Tars1	A	T	15: 11,397,196 (GRCm38)	D40E	probably damaging	Het
Tlr3	T	C	8: 45,397,814 (GRCm38)	H158R	probably benign	Het
Tppp2	G	T	14: 51,918,935 (GRCm38)	V50L	probably benign	Het
Ttll4	T	G	1: 74,685,391 (GRCm38)	S573R	probably damaging	Het
Vmn2r104	A	T	17: 20,029,485 (GRCm38)	N841K	probably damaging	Het
Vmn2r3	A	T	3: 64,259,647 (GRCm38)	C688S	probably damaging	Het
Vps16	T	C	2: 130,424,449 (GRCm38)		probably null	Het
Zfp608	G	A	18: 54,899,248 (GRCm38)	T540I	probably benign	Het
Zfp775	G	A	6: 48,619,816 (GRCm38)	R208Q	probably damaging	Het

Other mutations in Trrap

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Trrap	APN	5	144,779,974 (GRCm38)	splice site	probably benign
IGL00470:Trrap	APN	5	144,818,038 (GRCm38)	missense	probably damaging	1.00
IGL00490:Trrap	APN	5	144,825,225 (GRCm38)	missense	probably benign	0.40
IGL01072:Trrap	APN	5	144,784,255 (GRCm38)	splice site	probably benign
IGL01087:Trrap	APN	5	144,846,539 (GRCm38)	missense	probably damaging	0.99
IGL01300:Trrap	APN	5	144,804,818 (GRCm38)	missense	probably damaging	1.00
IGL01350:Trrap	APN	5	144,830,969 (GRCm38)	missense	possibly damaging	0.92
IGL01410:Trrap	APN	5	144,831,021 (GRCm38)	missense	probably benign	0.00
IGL01571:Trrap	APN	5	144,833,287 (GRCm38)	splice site	probably benign
IGL01748:Trrap	APN	5	144,833,340 (GRCm38)	missense	probably damaging	1.00
IGL01839:Trrap	APN	5	144,821,875 (GRCm38)	missense	probably damaging	1.00
IGL01976:Trrap	APN	5	144,856,989 (GRCm38)	missense	probably benign	0.00
IGL02075:Trrap	APN	5	144,828,494 (GRCm38)	missense	probably benign	0.00
IGL02127:Trrap	APN	5	144,816,433 (GRCm38)	missense	probably benign	0.22
IGL02131:Trrap	APN	5	144,840,436 (GRCm38)	missense	probably damaging	1.00
IGL02287:Trrap	APN	5	144,832,538 (GRCm38)	missense	probably damaging	1.00
IGL02301:Trrap	APN	5	144,777,917 (GRCm38)	missense	probably benign	0.05
IGL02336:Trrap	APN	5	144,798,390 (GRCm38)	missense	probably benign	0.39
IGL02526:Trrap	APN	5	144,824,550 (GRCm38)	missense	probably benign	0.00
IGL02873:Trrap	APN	5	144,841,079 (GRCm38)	splice site	probably benign
IGL02953:Trrap	APN	5	144,815,964 (GRCm38)	missense	probably damaging	0.99
IGL03404:Trrap	APN	5	144,833,186 (GRCm38)	missense	probably benign	0.00
Buffer	UTSW	5	144,834,204 (GRCm38)	missense	probably benign	0.06
Card-tower	UTSW	5	144,804,766 (GRCm38)	missense	probably damaging	1.00
Cookie	UTSW	5	144,794,049 (GRCm38)	missense	probably damaging	1.00
Glass_house	UTSW	5	144,845,477 (GRCm38)	missense	possibly damaging	0.67
Immovable	UTSW	5	144,790,855 (GRCm38)	missense	possibly damaging	0.66
R5049_trrap_520	UTSW	5	144,826,717 (GRCm38)	missense	probably damaging	1.00
R7167_Trrap_977	UTSW	5	144,839,614 (GRCm38)	missense	probably benign	0.39
vitreous	UTSW	5	144,805,727 (GRCm38)	missense	probably damaging	1.00
PIT4243001:Trrap	UTSW	5	144,796,971 (GRCm38)	missense	probably benign	0.00
PIT4466001:Trrap	UTSW	5	144,828,600 (GRCm38)	missense	probably benign	0.02
R0062:Trrap	UTSW	5	144,782,193 (GRCm38)	splice site	probably benign
R0062:Trrap	UTSW	5	144,782,193 (GRCm38)	splice site	probably benign
R0112:Trrap	UTSW	5	144,822,761 (GRCm38)	nonsense	probably null
R0126:Trrap	UTSW	5	144,805,750 (GRCm38)	nonsense	probably null
R0257:Trrap	UTSW	5	144,804,235 (GRCm38)	missense	probably benign	0.31
R0325:Trrap	UTSW	5	144,816,395 (GRCm38)	missense	probably benign	0.05
R0376:Trrap	UTSW	5	144,816,339 (GRCm38)	missense	probably benign	0.03
R0396:Trrap	UTSW	5	144,814,556 (GRCm38)	missense	probably damaging	0.99
R0448:Trrap	UTSW	5	144,839,567 (GRCm38)	missense	possibly damaging	0.66
R0454:Trrap	UTSW	5	144,846,477 (GRCm38)	missense	probably damaging	1.00
R0711:Trrap	UTSW	5	144,853,499 (GRCm38)	missense	probably damaging	1.00
R0827:Trrap	UTSW	5	144,814,830 (GRCm38)	missense	probably benign	0.00
R1005:Trrap	UTSW	5	144,805,727 (GRCm38)	missense	probably damaging	1.00
R1147:Trrap	UTSW	5	144,804,766 (GRCm38)	missense	probably damaging	1.00
R1147:Trrap	UTSW	5	144,804,766 (GRCm38)	missense	probably damaging	1.00
R1179:Trrap	UTSW	5	144,777,939 (GRCm38)	missense	possibly damaging	0.94
R1218:Trrap	UTSW	5	144,816,409 (GRCm38)	missense	probably damaging	1.00
R1264:Trrap	UTSW	5	144,789,599 (GRCm38)	splice site	probably benign
R1374:Trrap	UTSW	5	144,846,618 (GRCm38)	missense	probably damaging	1.00
R1401:Trrap	UTSW	5	144,857,422 (GRCm38)	missense	possibly damaging	0.93
R1480:Trrap	UTSW	5	144,818,313 (GRCm38)	missense	probably benign
R1538:Trrap	UTSW	5	144,837,202 (GRCm38)	missense	possibly damaging	0.65
R1751:Trrap	UTSW	5	144,814,575 (GRCm38)	critical splice donor site	probably null
R1779:Trrap	UTSW	5	144,828,590 (GRCm38)	missense	probably benign	0.01
R1782:Trrap	UTSW	5	144,822,703 (GRCm38)	missense	possibly damaging	0.93
R1792:Trrap	UTSW	5	144,853,586 (GRCm38)	missense	possibly damaging	0.87
R1859:Trrap	UTSW	5	144,830,951 (GRCm38)	missense	probably benign	0.04
R1861:Trrap	UTSW	5	144,815,917 (GRCm38)	splice site	probably null
R1902:Trrap	UTSW	5	144,816,053 (GRCm38)	missense	probably damaging	1.00
R1903:Trrap	UTSW	5	144,816,053 (GRCm38)	missense	probably damaging	1.00
R2021:Trrap	UTSW	5	144,853,488 (GRCm38)	missense	possibly damaging	0.94
R2026:Trrap	UTSW	5	144,803,044 (GRCm38)	missense	possibly damaging	0.86
R2036:Trrap	UTSW	5	144,828,562 (GRCm38)	missense	probably benign	0.08
R2099:Trrap	UTSW	5	144,782,239 (GRCm38)	missense	possibly damaging	0.46
R2108:Trrap	UTSW	5	144,825,874 (GRCm38)	missense	probably benign	0.01
R2113:Trrap	UTSW	5	144,844,211 (GRCm38)	missense	probably damaging	1.00
R2174:Trrap	UTSW	5	144,821,855 (GRCm38)	missense	probably benign	0.40
R2442:Trrap	UTSW	5	144,817,966 (GRCm38)	missense	probably damaging	1.00
R2568:Trrap	UTSW	5	144,843,369 (GRCm38)	critical splice donor site	probably null
R3442:Trrap	UTSW	5	144,792,252 (GRCm38)	missense	probably benign	0.03
R3853:Trrap	UTSW	5	144,792,165 (GRCm38)	missense	probably damaging	1.00
R4401:Trrap	UTSW	5	144,843,318 (GRCm38)	missense	possibly damaging	0.60
R4493:Trrap	UTSW	5	144,831,048 (GRCm38)	missense	probably benign	0.21
R4524:Trrap	UTSW	5	144,825,321 (GRCm38)	missense	probably benign	0.38
R4569:Trrap	UTSW	5	144,792,118 (GRCm38)	missense	probably benign	0.13
R4672:Trrap	UTSW	5	144,785,480 (GRCm38)	missense	probably damaging	0.97
R4732:Trrap	UTSW	5	144,816,570 (GRCm38)	missense	probably damaging	1.00
R4733:Trrap	UTSW	5	144,816,570 (GRCm38)	missense	probably damaging	1.00
R4791:Trrap	UTSW	5	144,803,277 (GRCm38)	missense	probably damaging	1.00
R4795:Trrap	UTSW	5	144,832,488 (GRCm38)	missense	probably benign	0.06
R4827:Trrap	UTSW	5	144,800,948 (GRCm38)	missense	probably benign	0.02
R4839:Trrap	UTSW	5	144,845,592 (GRCm38)	missense	probably damaging	1.00
R4915:Trrap	UTSW	5	144,805,735 (GRCm38)	missense	probably damaging	0.99
R4951:Trrap	UTSW	5	144,805,720 (GRCm38)	missense	possibly damaging	0.65
R4959:Trrap	UTSW	5	144,856,960 (GRCm38)	missense	probably damaging	1.00
R5049:Trrap	UTSW	5	144,826,717 (GRCm38)	missense	probably damaging	1.00
R5074:Trrap	UTSW	5	144,851,179 (GRCm38)	missense	probably damaging	1.00
R5236:Trrap	UTSW	5	144,817,786 (GRCm38)	missense	probably benign	0.07
R5281:Trrap	UTSW	5	144,813,503 (GRCm38)	missense	probably benign	0.13
R5322:Trrap	UTSW	5	144,844,224 (GRCm38)	missense	probably damaging	1.00
R5457:Trrap	UTSW	5	144,849,977 (GRCm38)	missense	probably damaging	1.00
R5590:Trrap	UTSW	5	144,782,265 (GRCm38)	missense	probably benign	0.05
R5799:Trrap	UTSW	5	144,830,945 (GRCm38)	missense	probably benign
R5885:Trrap	UTSW	5	144,794,793 (GRCm38)	missense	probably damaging	1.00
R5905:Trrap	UTSW	5	144,849,920 (GRCm38)	missense	possibly damaging	0.95
R5908:Trrap	UTSW	5	144,786,708 (GRCm38)	missense	probably damaging	0.96
R5956:Trrap	UTSW	5	144,807,391 (GRCm38)	splice site	silent
R6017:Trrap	UTSW	5	144,844,241 (GRCm38)	missense	probably damaging	1.00
R6029:Trrap	UTSW	5	144,825,914 (GRCm38)	missense	possibly damaging	0.75
R6029:Trrap	UTSW	5	144,817,679 (GRCm38)	missense	possibly damaging	0.94
R6117:Trrap	UTSW	5	144,802,961 (GRCm38)	missense	possibly damaging	0.78
R6166:Trrap	UTSW	5	144,781,981 (GRCm38)	missense	possibly damaging	0.66
R6234:Trrap	UTSW	5	144,839,713 (GRCm38)	splice site	probably null
R6288:Trrap	UTSW	5	144,811,992 (GRCm38)	missense	probably damaging	1.00
R6290:Trrap	UTSW	5	144,805,018 (GRCm38)	missense	probably damaging	1.00
R6316:Trrap	UTSW	5	144,813,526 (GRCm38)	missense	probably benign	0.02
R6398:Trrap	UTSW	5	144,790,870 (GRCm38)	missense	possibly damaging	0.83
R6413:Trrap	UTSW	5	144,784,046 (GRCm38)	missense	possibly damaging	0.83
R6499:Trrap	UTSW	5	144,857,002 (GRCm38)	missense	probably damaging	1.00
R6529:Trrap	UTSW	5	144,834,204 (GRCm38)	missense	probably benign	0.06
R6574:Trrap	UTSW	5	144,815,550 (GRCm38)	critical splice donor site	probably null
R6631:Trrap	UTSW	5	144,771,650 (GRCm38)	missense	possibly damaging	0.94
R6727:Trrap	UTSW	5	144,856,950 (GRCm38)	missense	probably damaging	1.00
R6776:Trrap	UTSW	5	144,851,256 (GRCm38)	nonsense	probably null
R6914:Trrap	UTSW	5	144,784,043 (GRCm38)	missense	possibly damaging	0.83
R6942:Trrap	UTSW	5	144,784,043 (GRCm38)	missense	possibly damaging	0.83
R6945:Trrap	UTSW	5	144,790,855 (GRCm38)	missense	possibly damaging	0.66
R7023:Trrap	UTSW	5	144,792,154 (GRCm38)	missense	possibly damaging	0.64
R7107:Trrap	UTSW	5	144,797,135 (GRCm38)	missense	probably benign	0.05
R7139:Trrap	UTSW	5	144,803,178 (GRCm38)	missense	possibly damaging	0.65
R7148:Trrap	UTSW	5	144,821,803 (GRCm38)	missense	possibly damaging	0.77
R7167:Trrap	UTSW	5	144,839,614 (GRCm38)	missense	probably benign	0.39
R7171:Trrap	UTSW	5	144,794,049 (GRCm38)	missense	probably damaging	1.00
R7205:Trrap	UTSW	5	144,842,707 (GRCm38)	missense	possibly damaging	0.94
R7215:Trrap	UTSW	5	144,797,135 (GRCm38)	missense	probably benign	0.05
R7255:Trrap	UTSW	5	144,858,954 (GRCm38)	missense	probably damaging	1.00
R7261:Trrap	UTSW	5	144,845,477 (GRCm38)	missense	possibly damaging	0.67
R7264:Trrap	UTSW	5	144,814,523 (GRCm38)	missense	probably benign	0.05
R7372:Trrap	UTSW	5	144,789,398 (GRCm38)	missense	probably benign
R7447:Trrap	UTSW	5	144,839,474 (GRCm38)	missense	probably damaging	0.97
R7449:Trrap	UTSW	5	144,851,209 (GRCm38)	missense	probably damaging	1.00
R7655:Trrap	UTSW	5	144,842,612 (GRCm38)	missense	probably damaging	1.00
R7656:Trrap	UTSW	5	144,842,612 (GRCm38)	missense	probably damaging	1.00
R7662:Trrap	UTSW	5	144,832,511 (GRCm38)	missense	probably benign	0.00
R7716:Trrap	UTSW	5	144,777,146 (GRCm38)	missense	possibly damaging	0.73
R8143:Trrap	UTSW	5	144,835,897 (GRCm38)	splice site	probably null
R8183:Trrap	UTSW	5	144,828,533 (GRCm38)	missense	probably benign	0.01
R8265:Trrap	UTSW	5	144,785,534 (GRCm38)	missense	possibly damaging	0.53
R8273:Trrap	UTSW	5	144,791,165 (GRCm38)	missense	probably damaging	1.00
R8556:Trrap	UTSW	5	144,825,937 (GRCm38)	missense	probably benign	0.44
R8674:Trrap	UTSW	5	144,791,032 (GRCm38)	missense	probably benign	0.02
R8777:Trrap	UTSW	5	144,837,139 (GRCm38)	missense	probably benign	0.10
R8777-TAIL:Trrap	UTSW	5	144,837,139 (GRCm38)	missense	probably benign	0.10
R8817:Trrap	UTSW	5	144,845,538 (GRCm38)	missense	probably damaging	1.00
R8841:Trrap	UTSW	5	144,844,211 (GRCm38)	missense	probably damaging	1.00
R8871:Trrap	UTSW	5	144,821,839 (GRCm38)	missense	probably benign	0.30
R8937:Trrap	UTSW	5	144,820,253 (GRCm38)	missense	probably damaging	1.00
R8966:Trrap	UTSW	5	144,803,352 (GRCm38)	missense	probably damaging	0.96
R9010:Trrap	UTSW	5	144,846,416 (GRCm38)	missense	probably damaging	1.00
R9095:Trrap	UTSW	5	144,797,151 (GRCm38)	missense	probably damaging	1.00
R9127:Trrap	UTSW	5	144,831,020 (GRCm38)	missense	probably benign	0.16
R9132:Trrap	UTSW	5	144,789,552 (GRCm38)	missense	probably benign	0.03
R9224:Trrap	UTSW	5	144,771,239 (GRCm38)	missense	possibly damaging	0.70
R9338:Trrap	UTSW	5	144,791,115 (GRCm38)	missense	probably benign
R9380:Trrap	UTSW	5	144,833,171 (GRCm38)	missense	probably benign
R9404:Trrap	UTSW	5	144,815,415 (GRCm38)	missense	possibly damaging	0.85
R9457:Trrap	UTSW	5	144,826,668 (GRCm38)	missense	probably damaging	1.00
R9464:Trrap	UTSW	5	144,826,707 (GRCm38)	missense	probably damaging	0.99
R9504:Trrap	UTSW	5	144,806,094 (GRCm38)	missense	probably damaging	1.00
R9583:Trrap	UTSW	5	144,840,520 (GRCm38)	missense	probably damaging	1.00
R9584:Trrap	UTSW	5	144,840,520 (GRCm38)	missense	probably damaging	1.00
R9585:Trrap	UTSW	5	144,840,520 (GRCm38)	missense	probably damaging	1.00
R9608:Trrap	UTSW	5	144,843,318 (GRCm38)	missense	possibly damaging	0.60
R9728:Trrap	UTSW	5	144,789,383 (GRCm38)	missense	probably benign	0.22
R9782:Trrap	UTSW	5	144,821,906 (GRCm38)	missense	probably damaging	0.99
X0060:Trrap	UTSW	5	144,843,361 (GRCm38)	missense	probably damaging	0.96
Z1088:Trrap	UTSW	5	144,834,197 (GRCm38)	missense	probably benign	0.00
Z1177:Trrap	UTSW	5	144,819,708 (GRCm38)	missense	probably damaging	1.00
Z1177:Trrap	UTSW	5	144,810,344 (GRCm38)	missense
Z1177:Trrap	UTSW	5	144,856,951 (GRCm38)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGAGTGTCTTAACTACTGTGTGC -3'
(R):5'- TAACGAGGTCACGGCAGAAC -3'

Sequencing Primer
(F):5'- AACTACTGTGTGCTTTCTGATTATCG -3'
(R):5'- GTCACGGCAGAACCAGATGC -3'

Posted On

2017-06-26