Incidental Mutation 'R5992:Fcgbp'
ID480886
Institutional Source Beutler Lab
Gene Symbol Fcgbp
Ensembl Gene ENSMUSG00000047730
Gene NameFc fragment of IgG binding protein
SynonymsA430096B05Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5992 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location28071236-28120862 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28120534 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 2562 (Y2562F)
Ref Sequence ENSEMBL: ENSMUSP00000114271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076648] [ENSMUST00000138392]
Predicted Effect probably benign
Transcript: ENSMUST00000076648
AA Change: Y2562F

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000075945
Gene: ENSMUSG00000047730
AA Change: Y2562F

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
FOLN 27 49 2.3e-4 SMART
VWD 46 211 5.26e-45 SMART
low complexity region 226 237 N/A INTRINSIC
C8 251 326 1.17e-34 SMART
Pfam:TIL 329 383 1.2e-12 PFAM
VWC 385 431 2.34e-1 SMART
FOLN 418 441 3.48e1 SMART
VWD 438 603 6.85e-35 SMART
C8 642 717 1.4e-32 SMART
Pfam:TIL 720 773 4.7e-14 PFAM
VWC 775 829 9.42e-1 SMART
VWD 824 990 7.86e-44 SMART
C8 1034 1109 1.66e-34 SMART
Pfam:TIL 1112 1165 6.7e-13 PFAM
VWC 1167 1225 9.8e-3 SMART
FOLN 1198 1220 9.55e-1 SMART
FOLN 1224 1246 2.41e0 SMART
VWD 1243 1411 6.59e-37 SMART
C8 1451 1527 5.6e-32 SMART
low complexity region 1541 1551 N/A INTRINSIC
EGF_like 1558 1581 6.15e1 SMART
VWC 1589 1682 1.6e-2 SMART
VWD 1640 1807 5.15e-39 SMART
C8 1839 1914 4.62e-33 SMART
EGF_like 1942 1965 4.46e1 SMART
VWC 1972 2064 1.92e-1 SMART
VWD 2024 2180 6.34e-39 SMART
low complexity region 2201 2214 N/A INTRINSIC
C8 2221 2296 3.7e-32 SMART
Pfam:TIL 2299 2352 5e-12 PFAM
VWC 2354 2413 8.29e-1 SMART
FOLN 2385 2407 4.96e1 SMART
VWD 2404 2566 1.89e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131090
Predicted Effect probably benign
Transcript: ENSMUST00000138392
AA Change: Y2562F

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000114271
Gene: ENSMUSG00000047730
AA Change: Y2562F

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
FOLN 27 49 2.3e-4 SMART
VWD 46 211 5.26e-45 SMART
low complexity region 226 237 N/A INTRINSIC
C8 251 326 1.17e-34 SMART
Pfam:TIL 329 383 8.4e-13 PFAM
VWC 385 431 2.34e-1 SMART
FOLN 418 441 3.48e1 SMART
VWD 438 603 7.99e-36 SMART
C8 642 717 1.4e-32 SMART
Pfam:TIL 720 773 3.3e-14 PFAM
VWC 775 829 9.42e-1 SMART
VWD 824 990 7.86e-44 SMART
C8 1034 1109 1.66e-34 SMART
Pfam:TIL 1112 1165 6.9e-13 PFAM
VWC 1167 1225 9.8e-3 SMART
FOLN 1198 1220 9.55e-1 SMART
FOLN 1224 1246 2.41e0 SMART
VWD 1243 1411 6.59e-37 SMART
C8 1451 1527 5.6e-32 SMART
low complexity region 1541 1551 N/A INTRINSIC
EGF_like 1558 1581 6.15e1 SMART
VWC 1589 1682 1.6e-2 SMART
VWD 1640 1807 5.15e-39 SMART
C8 1839 1914 4.62e-33 SMART
EGF_like 1942 1965 4.46e1 SMART
VWC 1972 2064 1.92e-1 SMART
VWD 2024 2180 6.34e-39 SMART
low complexity region 2201 2214 N/A INTRINSIC
C8 2221 2296 3.7e-32 SMART
Pfam:TIL 2299 2352 1e-11 PFAM
VWC 2354 2413 8.29e-1 SMART
FOLN 2385 2407 4.96e1 SMART
VWD 2404 2566 1.89e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148946
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154481
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,508,623 L188* probably null Het
Acod1 C T 14: 103,055,035 R332C probably damaging Het
Adamts3 T A 5: 89,691,335 K852M probably damaging Het
Adm A T 7: 110,627,696 probably benign Het
Aff4 A G 11: 53,373,010 S286G probably damaging Het
Ank2 A G 3: 126,959,651 probably null Het
Aqr A T 2: 114,143,049 Y427* probably null Het
Arid1b C A 17: 4,994,956 probably benign Het
Arpp21 T A 9: 112,143,485 R259* probably null Het
Cep290 C T 10: 100,543,321 A55V possibly damaging Het
Chsy3 GT G 18: 59,176,166 probably null Het
Clcn2 T C 16: 20,713,654 E68G possibly damaging Het
Corin T A 5: 72,316,389 H699L probably benign Het
Cyld T C 8: 88,733,053 Y446H probably damaging Het
Dcst1 T A 3: 89,352,576 E613V probably damaging Het
Dlk1 T C 12: 109,455,581 C74R probably damaging Het
Dnah12 A C 14: 26,697,341 K128T probably benign Het
Dspp T A 5: 104,178,451 S893R unknown Het
Dtl A T 1: 191,568,572 probably null Het
F2rl1 T A 13: 95,514,270 S35C probably benign Het
Fgf10 A T 13: 118,715,508 D42V probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm21190 T A 5: 15,524,851 E256D probably damaging Het
Gm5157 A G 7: 21,185,421 S66P probably damaging Het
Gm884 A T 11: 103,613,792 M2450K possibly damaging Het
Hal T G 10: 93,490,916 L138R probably damaging Het
Hsd17b3 T C 13: 64,059,470 probably null Het
Lrsam1 T C 2: 32,955,222 T94A probably benign Het
Macc1 T C 12: 119,447,585 V696A probably damaging Het
Magi2 G A 5: 19,227,291 M1I probably null Het
March7 C A 2: 60,245,220 N674K probably benign Het
Mfap1b A G 2: 121,470,295 V34A probably benign Het
Mob3b G A 4: 35,084,069 S40L probably benign Het
Ndufs2 A T 1: 171,236,418 V386E probably damaging Het
Nfic C T 10: 81,420,747 A19T probably damaging Het
Nfs1 G A 2: 156,134,453 R174W probably damaging Het
Nin G T 12: 70,045,524 S670R possibly damaging Het
Nrxn1 T C 17: 90,623,507 I754V probably benign Het
Nwd1 T C 8: 72,653,573 probably null Het
Olfr1231 T A 2: 89,303,359 T78S possibly damaging Het
Olfr1238 T A 2: 89,406,879 M67L probably benign Het
Olfr575 G T 7: 102,955,009 N197K probably benign Het
Pcdhgb8 A G 18: 37,763,449 E524G probably damaging Het
Phlpp1 A T 1: 106,318,993 R638* probably null Het
Pkmyt1 G C 17: 23,735,326 W360S probably benign Het
Plxnd1 C A 6: 115,967,787 probably null Het
Poldip3 A T 15: 83,129,229 N322K probably damaging Het
Prmt3 A T 7: 49,828,947 I419L probably benign Het
Prss36 A T 7: 127,944,830 V123E probably damaging Het
Prss58 A G 6: 40,897,769 I46T probably damaging Het
Rac1 T C 5: 143,506,998 probably benign Het
Rb1cc1 A G 1: 6,233,996 Y36C probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rp1 A T 1: 4,148,703 F951L unknown Het
Rps6ka5 G T 12: 100,575,250 P417T possibly damaging Het
Ryr1 A G 7: 29,067,637 W2967R probably damaging Het
Sacs T A 14: 61,205,543 S1679R probably damaging Het
Scn1a A C 2: 66,335,456 W153G probably damaging Het
Serpinb7 A G 1: 107,445,996 Y114C probably damaging Het
Son T C 16: 91,658,904 M1513T probably benign Het
Spag8 C T 4: 43,651,534 V447M probably benign Het
St3gal2 T A 8: 110,969,553 Y257N probably damaging Het
Tars A T 15: 11,397,196 D40E probably damaging Het
Tlr3 T C 8: 45,397,814 H158R probably benign Het
Tppp2 G T 14: 51,918,935 V50L probably benign Het
Trrap T C 5: 144,810,184 S1503P probably benign Het
Ttll4 T G 1: 74,685,391 S573R probably damaging Het
Vmn2r104 A T 17: 20,029,485 N841K probably damaging Het
Vmn2r3 A T 3: 64,259,647 C688S probably damaging Het
Vps16 T C 2: 130,424,449 probably null Het
Zfp608 G A 18: 54,899,248 T540I probably benign Het
Zfp775 G A 6: 48,619,816 R208Q probably damaging Het
Other mutations in Fcgbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Fcgbp APN 7 28085130 missense probably damaging 1.00
IGL00331:Fcgbp APN 7 28101541 splice site probably benign
IGL00335:Fcgbp APN 7 28086135 missense possibly damaging 0.90
IGL00470:Fcgbp APN 7 28075086 nonsense probably null
IGL00491:Fcgbp APN 7 28093402 missense probably damaging 1.00
IGL00498:Fcgbp APN 7 28091797 missense probably damaging 1.00
IGL01296:Fcgbp APN 7 28089647 missense probably benign 0.15
IGL01582:Fcgbp APN 7 28093642 missense probably benign 0.19
IGL01929:Fcgbp APN 7 28103963 missense probably damaging 1.00
IGL02024:Fcgbp APN 7 28106374 missense probably damaging 1.00
IGL02027:Fcgbp APN 7 28075204 missense probably damaging 1.00
IGL02140:Fcgbp APN 7 28091954 missense probably damaging 1.00
IGL02162:Fcgbp APN 7 28075235 missense probably damaging 1.00
IGL02345:Fcgbp APN 7 28071643 splice site probably benign
IGL02377:Fcgbp APN 7 28106970 missense possibly damaging 0.67
IGL02389:Fcgbp APN 7 28075171 missense probably damaging 1.00
IGL02423:Fcgbp APN 7 28089953 missense probably benign 0.02
IGL02523:Fcgbp APN 7 28104732 missense possibly damaging 0.89
IGL02561:Fcgbp APN 7 28101174 intron probably benign
IGL02631:Fcgbp APN 7 28085298 missense probably damaging 1.00
IGL02716:Fcgbp APN 7 28101434 missense probably damaging 0.98
IGL02836:Fcgbp APN 7 28117358 missense possibly damaging 0.91
IGL02957:Fcgbp APN 7 28091847 nonsense probably null
IGL02971:Fcgbp APN 7 28101473 missense probably damaging 1.00
IGL03284:Fcgbp APN 7 28085432 missense possibly damaging 0.93
IGL03379:Fcgbp APN 7 28089917 missense possibly damaging 0.76
IGL02796:Fcgbp UTSW 7 28101151 intron probably benign
PIT4486001:Fcgbp UTSW 7 28075273 missense possibly damaging 0.52
R0277:Fcgbp UTSW 7 28085493 critical splice donor site probably null
R0387:Fcgbp UTSW 7 28091454 splice site probably benign
R0586:Fcgbp UTSW 7 28089713 missense probably damaging 1.00
R0981:Fcgbp UTSW 7 28085110 nonsense probably null
R0987:Fcgbp UTSW 7 28094174 missense probably damaging 1.00
R1240:Fcgbp UTSW 7 28120525 missense probably damaging 1.00
R1394:Fcgbp UTSW 7 28093379 missense probably damaging 0.98
R1395:Fcgbp UTSW 7 28093379 missense probably damaging 0.98
R1438:Fcgbp UTSW 7 28103733 nonsense probably null
R1474:Fcgbp UTSW 7 28091848 missense probably benign 0.00
R1521:Fcgbp UTSW 7 28075160 missense probably benign 0.00
R1740:Fcgbp UTSW 7 28101249 missense possibly damaging 0.87
R1750:Fcgbp UTSW 7 28093443 nonsense probably null
R1772:Fcgbp UTSW 7 28105175 missense possibly damaging 0.90
R1804:Fcgbp UTSW 7 28086139 missense probably benign
R1808:Fcgbp UTSW 7 28085090 missense probably benign 0.04
R1819:Fcgbp UTSW 7 28085283 missense probably benign 0.00
R1934:Fcgbp UTSW 7 28107093 missense probably damaging 1.00
R1972:Fcgbp UTSW 7 28094192 missense probably benign 0.11
R2051:Fcgbp UTSW 7 28120360 missense probably damaging 0.97
R2072:Fcgbp UTSW 7 28120389 missense probably damaging 0.98
R2074:Fcgbp UTSW 7 28120389 missense probably damaging 0.98
R2124:Fcgbp UTSW 7 28092019 missense probably benign 0.03
R2155:Fcgbp UTSW 7 28107203 missense probably benign 0.00
R3015:Fcgbp UTSW 7 28075413 splice site probably benign
R3037:Fcgbp UTSW 7 28102702 missense possibly damaging 0.62
R3151:Fcgbp UTSW 7 28117240 missense probably damaging 1.00
R3176:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3177:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3276:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3277:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3623:Fcgbp UTSW 7 28101276 missense probably damaging 1.00
R3730:Fcgbp UTSW 7 28085457 missense possibly damaging 0.82
R3935:Fcgbp UTSW 7 28075399 missense probably benign 0.00
R3936:Fcgbp UTSW 7 28075399 missense probably benign 0.00
R4041:Fcgbp UTSW 7 28113979 missense probably benign 0.01
R4056:Fcgbp UTSW 7 28104116 missense probably benign 0.09
R4057:Fcgbp UTSW 7 28104116 missense probably benign 0.09
R4705:Fcgbp UTSW 7 28107296 missense probably benign 0.44
R4708:Fcgbp UTSW 7 28094961 missense probably benign 0.00
R4710:Fcgbp UTSW 7 28094961 missense probably benign 0.00
R4779:Fcgbp UTSW 7 28094937 missense probably damaging 1.00
R4820:Fcgbp UTSW 7 28113958 missense probably damaging 1.00
R4863:Fcgbp UTSW 7 28086344 missense probably benign 0.33
R4926:Fcgbp UTSW 7 28086235 missense probably damaging 0.99
R4947:Fcgbp UTSW 7 28089812 missense probably benign 0.00
R4979:Fcgbp UTSW 7 28117570 missense probably benign 0.06
R5002:Fcgbp UTSW 7 28086103 splice site probably null
R5219:Fcgbp UTSW 7 28104085 missense probably damaging 1.00
R5241:Fcgbp UTSW 7 28085199 missense probably damaging 1.00
R5301:Fcgbp UTSW 7 28093674 missense possibly damaging 0.93
R5306:Fcgbp UTSW 7 28091818 missense probably damaging 1.00
R5335:Fcgbp UTSW 7 28089734 missense probably damaging 1.00
R5399:Fcgbp UTSW 7 28105055 missense probably benign 0.05
R5418:Fcgbp UTSW 7 28085313 missense probably damaging 1.00
R5527:Fcgbp UTSW 7 28093635 missense probably benign
R5583:Fcgbp UTSW 7 28091579 missense probably damaging 1.00
R5698:Fcgbp UTSW 7 28092022 missense possibly damaging 0.95
R5780:Fcgbp UTSW 7 28085218 missense probably benign 0.02
R5813:Fcgbp UTSW 7 28101494 missense possibly damaging 0.64
R5910:Fcgbp UTSW 7 28085503 splice site probably benign
R5936:Fcgbp UTSW 7 28086692 missense probably damaging 0.98
R6091:Fcgbp UTSW 7 28104965 missense possibly damaging 0.90
R6372:Fcgbp UTSW 7 28107008 missense probably damaging 1.00
R6488:Fcgbp UTSW 7 28093538 missense probably damaging 0.96
R6548:Fcgbp UTSW 7 28091918 missense probably benign 0.00
R6553:Fcgbp UTSW 7 28113979 missense possibly damaging 0.79
R6585:Fcgbp UTSW 7 28113979 missense possibly damaging 0.79
R6695:Fcgbp UTSW 7 28086270 nonsense probably null
R6711:Fcgbp UTSW 7 28089673 missense probably damaging 0.99
R6803:Fcgbp UTSW 7 28103212 missense probably benign 0.00
R6822:Fcgbp UTSW 7 28107356 missense probably damaging 1.00
R6907:Fcgbp UTSW 7 28085018 missense probably damaging 1.00
R6912:Fcgbp UTSW 7 28089704 missense probably benign 0.15
R6924:Fcgbp UTSW 7 28093823 missense probably benign
R6943:Fcgbp UTSW 7 28092052 missense probably benign 0.22
R7060:Fcgbp UTSW 7 28091933 missense probably benign 0.20
R7103:Fcgbp UTSW 7 28084962 missense probably benign 0.00
R7208:Fcgbp UTSW 7 28104021 missense probably benign 0.01
R7291:Fcgbp UTSW 7 28101392 missense probably benign 0.00
R7301:Fcgbp UTSW 7 28093436 missense possibly damaging 0.65
R7404:Fcgbp UTSW 7 28101507 missense probably damaging 1.00
R7426:Fcgbp UTSW 7 28086524 missense probably benign 0.00
R7459:Fcgbp UTSW 7 28107285 missense possibly damaging 0.65
R7475:Fcgbp UTSW 7 28102976 missense probably damaging 0.99
R7505:Fcgbp UTSW 7 28089674 missense probably damaging 0.97
R7517:Fcgbp UTSW 7 28085369 missense probably damaging 1.00
R7519:Fcgbp UTSW 7 28086299 missense probably damaging 1.00
R7524:Fcgbp UTSW 7 28102966 missense probably damaging 1.00
R7649:Fcgbp UTSW 7 28091503 missense possibly damaging 0.88
R7782:Fcgbp UTSW 7 28085035 nonsense probably null
R7820:Fcgbp UTSW 7 28120359 missense probably benign 0.01
RF002:Fcgbp UTSW 7 28089755 missense probably benign
X0028:Fcgbp UTSW 7 28104020 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- ATCTCCCAGCTACTGTGTTAACATC -3'
(R):5'- GGTCTTGATGCCTTCAGTGC -3'

Sequencing Primer
(F):5'- AGCTACTGTGTTAACATCTGTGTC -3'
(R):5'- ATGCCTTCAGTGCCAGTG -3'
Posted On2017-06-26