Incidental Mutation 'R5992:Prmt3'
ID480888
Institutional Source Beutler Lab
Gene Symbol Prmt3
Ensembl Gene ENSMUSG00000030505
Gene Nameprotein arginine N-methyltransferase 3
SynonymsHrmt1l3, 2010005E20Rik, 2410018A17Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.663) question?
Stock #R5992 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location49778346-49858265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49828947 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 419 (I419L)
Ref Sequence ENSEMBL: ENSMUSP00000032715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032715] [ENSMUST00000147401]
Predicted Effect probably benign
Transcript: ENSMUST00000032715
AA Change: I419L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000032715
Gene: ENSMUSG00000030505
AA Change: I419L

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
ZnF_C2H2 46 69 2.41e1 SMART
coiled coil region 156 191 N/A INTRINSIC
Pfam:PRMT5 212 508 5.7e-8 PFAM
Pfam:Methyltransf_9 220 392 9.3e-9 PFAM
Pfam:MTS 242 326 5.4e-7 PFAM
Pfam:PrmA 245 343 4.3e-13 PFAM
Pfam:Methyltransf_31 250 407 8.8e-11 PFAM
Pfam:Methyltransf_18 252 360 2.5e-11 PFAM
Pfam:Methyltransf_11 257 356 1.1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130907
SMART Domains Protein: ENSMUSP00000114676
Gene: ENSMUSG00000030505

DomainStartEndE-ValueType
PDB:1F3L|A 1 135 3e-93 PDB
SCOP:d1f3la_ 2 135 2e-17 SMART
Blast:FBG 73 118 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000147401
SMART Domains Protein: ENSMUSP00000115155
Gene: ENSMUSG00000030505

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
PDB:1WIR|A 38 64 1e-13 PDB
Blast:ZnF_C2H2 46 64 1e-5 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protein arginine methyltransferase (PRMT) family. The encoded enzyme catalyzes the methylation of guanidino nitrogens of arginyl residues of proteins. The enzyme acts on 40S ribosomal protein S2 (rpS2), which is its major in-vivo substrate, and is involved in the proper maturation of the 80S ribosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a hypomorphic gene trap allele exhibit a reduced embryonic size but survive birth and attain a normal size in adulthood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,508,623 L188* probably null Het
Acod1 C T 14: 103,055,035 R332C probably damaging Het
Adamts3 T A 5: 89,691,335 K852M probably damaging Het
Adm A T 7: 110,627,696 probably benign Het
Aff4 A G 11: 53,373,010 S286G probably damaging Het
Ank2 A G 3: 126,959,651 probably null Het
Aqr A T 2: 114,143,049 Y427* probably null Het
Arid1b C A 17: 4,994,956 probably benign Het
Arpp21 T A 9: 112,143,485 R259* probably null Het
Cep290 C T 10: 100,543,321 A55V possibly damaging Het
Chsy3 GT G 18: 59,176,166 probably null Het
Clcn2 T C 16: 20,713,654 E68G possibly damaging Het
Corin T A 5: 72,316,389 H699L probably benign Het
Cyld T C 8: 88,733,053 Y446H probably damaging Het
Dcst1 T A 3: 89,352,576 E613V probably damaging Het
Dlk1 T C 12: 109,455,581 C74R probably damaging Het
Dnah12 A C 14: 26,697,341 K128T probably benign Het
Dspp T A 5: 104,178,451 S893R unknown Het
Dtl A T 1: 191,568,572 probably null Het
F2rl1 T A 13: 95,514,270 S35C probably benign Het
Fcgbp A T 7: 28,120,534 Y2562F probably benign Het
Fgf10 A T 13: 118,715,508 D42V probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm21190 T A 5: 15,524,851 E256D probably damaging Het
Gm5157 A G 7: 21,185,421 S66P probably damaging Het
Gm884 A T 11: 103,613,792 M2450K possibly damaging Het
Hal T G 10: 93,490,916 L138R probably damaging Het
Hsd17b3 T C 13: 64,059,470 probably null Het
Lrsam1 T C 2: 32,955,222 T94A probably benign Het
Macc1 T C 12: 119,447,585 V696A probably damaging Het
Magi2 G A 5: 19,227,291 M1I probably null Het
March7 C A 2: 60,245,220 N674K probably benign Het
Mfap1b A G 2: 121,470,295 V34A probably benign Het
Mob3b G A 4: 35,084,069 S40L probably benign Het
Ndufs2 A T 1: 171,236,418 V386E probably damaging Het
Nfic C T 10: 81,420,747 A19T probably damaging Het
Nfs1 G A 2: 156,134,453 R174W probably damaging Het
Nin G T 12: 70,045,524 S670R possibly damaging Het
Nrxn1 T C 17: 90,623,507 I754V probably benign Het
Nwd1 T C 8: 72,653,573 probably null Het
Olfr1231 T A 2: 89,303,359 T78S possibly damaging Het
Olfr1238 T A 2: 89,406,879 M67L probably benign Het
Olfr575 G T 7: 102,955,009 N197K probably benign Het
Pcdhgb8 A G 18: 37,763,449 E524G probably damaging Het
Phlpp1 A T 1: 106,318,993 R638* probably null Het
Pkmyt1 G C 17: 23,735,326 W360S probably benign Het
Plxnd1 C A 6: 115,967,787 probably null Het
Poldip3 A T 15: 83,129,229 N322K probably damaging Het
Prss36 A T 7: 127,944,830 V123E probably damaging Het
Prss58 A G 6: 40,897,769 I46T probably damaging Het
Rac1 T C 5: 143,506,998 probably benign Het
Rb1cc1 A G 1: 6,233,996 Y36C probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rp1 A T 1: 4,148,703 F951L unknown Het
Rps6ka5 G T 12: 100,575,250 P417T possibly damaging Het
Ryr1 A G 7: 29,067,637 W2967R probably damaging Het
Sacs T A 14: 61,205,543 S1679R probably damaging Het
Scn1a A C 2: 66,335,456 W153G probably damaging Het
Serpinb7 A G 1: 107,445,996 Y114C probably damaging Het
Son T C 16: 91,658,904 M1513T probably benign Het
Spag8 C T 4: 43,651,534 V447M probably benign Het
St3gal2 T A 8: 110,969,553 Y257N probably damaging Het
Tars A T 15: 11,397,196 D40E probably damaging Het
Tlr3 T C 8: 45,397,814 H158R probably benign Het
Tppp2 G T 14: 51,918,935 V50L probably benign Het
Trrap T C 5: 144,810,184 S1503P probably benign Het
Ttll4 T G 1: 74,685,391 S573R probably damaging Het
Vmn2r104 A T 17: 20,029,485 N841K probably damaging Het
Vmn2r3 A T 3: 64,259,647 C688S probably damaging Het
Vps16 T C 2: 130,424,449 probably null Het
Zfp608 G A 18: 54,899,248 T540I probably benign Het
Zfp775 G A 6: 48,619,816 R208Q probably damaging Het
Other mutations in Prmt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Prmt3 APN 7 49792009 missense probably damaging 1.00
IGL01444:Prmt3 APN 7 49780372 missense probably benign 0.00
IGL01688:Prmt3 APN 7 49848732 splice site probably null
IGL02041:Prmt3 APN 7 49828963 missense possibly damaging 0.91
IGL02304:Prmt3 APN 7 49826737 missense probably benign 0.44
IGL02389:Prmt3 APN 7 49848758 nonsense probably null
IGL02879:Prmt3 APN 7 49818063 missense probably benign 0.39
K7894:Prmt3 UTSW 7 49826711 missense probably damaging 1.00
R0616:Prmt3 UTSW 7 49787328 missense probably damaging 1.00
R0667:Prmt3 UTSW 7 49791995 missense probably damaging 1.00
R1170:Prmt3 UTSW 7 49848547 critical splice donor site probably null
R1343:Prmt3 UTSW 7 49818108 missense probably benign 0.19
R1562:Prmt3 UTSW 7 49826854 missense probably benign 0.00
R1614:Prmt3 UTSW 7 49826719 missense possibly damaging 0.95
R1777:Prmt3 UTSW 7 49798346 missense possibly damaging 0.92
R3113:Prmt3 UTSW 7 49782012 missense probably damaging 1.00
R4170:Prmt3 UTSW 7 49826776 missense probably benign 0.01
R4403:Prmt3 UTSW 7 49780357 missense probably damaging 1.00
R4463:Prmt3 UTSW 7 49818089 missense probably damaging 1.00
R4962:Prmt3 UTSW 7 49826809 missense probably benign 0.00
R5144:Prmt3 UTSW 7 49786135 missense possibly damaging 0.48
R5364:Prmt3 UTSW 7 49848806 missense probably damaging 1.00
R5586:Prmt3 UTSW 7 49826751 missense probably damaging 1.00
R5624:Prmt3 UTSW 7 49780334 missense probably damaging 0.97
R5820:Prmt3 UTSW 7 49848806 missense probably damaging 1.00
R6931:Prmt3 UTSW 7 49829016 missense probably benign 0.00
R7117:Prmt3 UTSW 7 49818095 missense probably benign 0.00
R7889:Prmt3 UTSW 7 49787301 missense possibly damaging 0.87
R7972:Prmt3 UTSW 7 49787301 missense possibly damaging 0.87
X0064:Prmt3 UTSW 7 49781974 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGATACCAACTTGACTTAGAGAACC -3'
(R):5'- GCAAAGGCAAAGACAGTCTGTC -3'

Sequencing Primer
(F):5'- CAACTTGACTTAGAGAACCGTTAAC -3'
(R):5'- CAGTCTGTCAATGGCAATAGCTG -3'
Posted On2017-06-26