Incidental Mutation 'R5992:Nwd1'
ID480893
Institutional Source Beutler Lab
Gene Symbol Nwd1
Ensembl Gene ENSMUSG00000048148
Gene NameNACHT and WD repeat domain containing 1
SynonymsA230063L24Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R5992 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location72646711-72717876 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 72653573 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093427] [ENSMUST00000093427] [ENSMUST00000160443] [ENSMUST00000161254] [ENSMUST00000161254] [ENSMUST00000161557] [ENSMUST00000228312]
Predicted Effect probably null
Transcript: ENSMUST00000093427
SMART Domains Protein: ENSMUSP00000091135
Gene: ENSMUSG00000048148

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 279 292 N/A INTRINSIC
Pfam:AAA_16 312 457 7.3e-8 PFAM
Pfam:NACHT 336 511 1.3e-12 PFAM
WD40 857 896 1.31e-3 SMART
WD40 899 938 7.97e-8 SMART
Blast:WD40 941 985 2e-15 BLAST
WD40 988 1028 2.05e1 SMART
Blast:WD40 1037 1073 2e-9 BLAST
Blast:WD40 1073 1110 4e-10 BLAST
WD40 1118 1156 5.97e-1 SMART
WD40 1160 1198 6.6e1 SMART
WD40 1245 1283 5.3e1 SMART
WD40 1286 1326 2.13e1 SMART
WD40 1340 1375 1.06e2 SMART
WD40 1377 1416 3.5e-4 SMART
WD40 1421 1461 2.66e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000093427
SMART Domains Protein: ENSMUSP00000091135
Gene: ENSMUSG00000048148

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 279 292 N/A INTRINSIC
Pfam:AAA_16 312 457 7.3e-8 PFAM
Pfam:NACHT 336 511 1.3e-12 PFAM
WD40 857 896 1.31e-3 SMART
WD40 899 938 7.97e-8 SMART
Blast:WD40 941 985 2e-15 BLAST
WD40 988 1028 2.05e1 SMART
Blast:WD40 1037 1073 2e-9 BLAST
Blast:WD40 1073 1110 4e-10 BLAST
WD40 1118 1156 5.97e-1 SMART
WD40 1160 1198 6.6e1 SMART
WD40 1245 1283 5.3e1 SMART
WD40 1286 1326 2.13e1 SMART
WD40 1340 1375 1.06e2 SMART
WD40 1377 1416 3.5e-4 SMART
WD40 1421 1461 2.66e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160443
SMART Domains Protein: ENSMUSP00000124446
Gene: ENSMUSG00000048148

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160912
Predicted Effect probably null
Transcript: ENSMUST00000161254
SMART Domains Protein: ENSMUSP00000124804
Gene: ENSMUSG00000048148

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 279 292 N/A INTRINSIC
low complexity region 319 329 N/A INTRINSIC
Pfam:NACHT 336 511 2.1e-12 PFAM
WD40 857 896 1.31e-3 SMART
WD40 899 938 7.97e-8 SMART
Blast:WD40 941 985 1e-15 BLAST
WD40 988 1028 2.05e1 SMART
Blast:WD40 1037 1073 2e-9 BLAST
Blast:WD40 1073 1110 3e-10 BLAST
WD40 1118 1156 2.49e-1 SMART
WD40 1203 1241 5.3e1 SMART
WD40 1244 1284 2.13e1 SMART
WD40 1298 1333 1.06e2 SMART
WD40 1335 1374 3.5e-4 SMART
WD40 1379 1419 2.66e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000161254
SMART Domains Protein: ENSMUSP00000124804
Gene: ENSMUSG00000048148

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 279 292 N/A INTRINSIC
low complexity region 319 329 N/A INTRINSIC
Pfam:NACHT 336 511 2.1e-12 PFAM
WD40 857 896 1.31e-3 SMART
WD40 899 938 7.97e-8 SMART
Blast:WD40 941 985 1e-15 BLAST
WD40 988 1028 2.05e1 SMART
Blast:WD40 1037 1073 2e-9 BLAST
Blast:WD40 1073 1110 3e-10 BLAST
WD40 1118 1156 2.49e-1 SMART
WD40 1203 1241 5.3e1 SMART
WD40 1244 1284 2.13e1 SMART
WD40 1298 1333 1.06e2 SMART
WD40 1335 1374 3.5e-4 SMART
WD40 1379 1419 2.66e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161386
SMART Domains Protein: ENSMUSP00000123737
Gene: ENSMUSG00000048148

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 279 292 N/A INTRINSIC
low complexity region 319 329 N/A INTRINSIC
Pfam:NACHT 336 511 1.2e-12 PFAM
WD40 857 896 1.31e-3 SMART
WD40 899 938 7.97e-8 SMART
Blast:WD40 941 984 1e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000161557
SMART Domains Protein: ENSMUSP00000125470
Gene: ENSMUSG00000048148

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163026
Predicted Effect probably null
Transcript: ENSMUST00000228312
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a cytosolic protein and predicted to contain a NACHT domain and multiple WD40 repeats. Increased expression of this gene was observed in some prostate cancer cell lines. Knocking down expression of this gene results in decreased androgen receptor protein levels, indicating that this gene may be important in modulating androgen receptor activity. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,508,623 L188* probably null Het
Acod1 C T 14: 103,055,035 R332C probably damaging Het
Adamts3 T A 5: 89,691,335 K852M probably damaging Het
Adm A T 7: 110,627,696 probably benign Het
Aff4 A G 11: 53,373,010 S286G probably damaging Het
Ank2 A G 3: 126,959,651 probably null Het
Aqr A T 2: 114,143,049 Y427* probably null Het
Arid1b C A 17: 4,994,956 probably benign Het
Arpp21 T A 9: 112,143,485 R259* probably null Het
Cep290 C T 10: 100,543,321 A55V possibly damaging Het
Chsy3 GT G 18: 59,176,166 probably null Het
Clcn2 T C 16: 20,713,654 E68G possibly damaging Het
Corin T A 5: 72,316,389 H699L probably benign Het
Cyld T C 8: 88,733,053 Y446H probably damaging Het
Dcst1 T A 3: 89,352,576 E613V probably damaging Het
Dlk1 T C 12: 109,455,581 C74R probably damaging Het
Dnah12 A C 14: 26,697,341 K128T probably benign Het
Dspp T A 5: 104,178,451 S893R unknown Het
Dtl A T 1: 191,568,572 probably null Het
F2rl1 T A 13: 95,514,270 S35C probably benign Het
Fcgbp A T 7: 28,120,534 Y2562F probably benign Het
Fgf10 A T 13: 118,715,508 D42V probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm21190 T A 5: 15,524,851 E256D probably damaging Het
Gm5157 A G 7: 21,185,421 S66P probably damaging Het
Gm884 A T 11: 103,613,792 M2450K possibly damaging Het
Hal T G 10: 93,490,916 L138R probably damaging Het
Hsd17b3 T C 13: 64,059,470 probably null Het
Lrsam1 T C 2: 32,955,222 T94A probably benign Het
Macc1 T C 12: 119,447,585 V696A probably damaging Het
Magi2 G A 5: 19,227,291 M1I probably null Het
March7 C A 2: 60,245,220 N674K probably benign Het
Mfap1b A G 2: 121,470,295 V34A probably benign Het
Mob3b G A 4: 35,084,069 S40L probably benign Het
Ndufs2 A T 1: 171,236,418 V386E probably damaging Het
Nfic C T 10: 81,420,747 A19T probably damaging Het
Nfs1 G A 2: 156,134,453 R174W probably damaging Het
Nin G T 12: 70,045,524 S670R possibly damaging Het
Nrxn1 T C 17: 90,623,507 I754V probably benign Het
Olfr1231 T A 2: 89,303,359 T78S possibly damaging Het
Olfr1238 T A 2: 89,406,879 M67L probably benign Het
Olfr575 G T 7: 102,955,009 N197K probably benign Het
Pcdhgb8 A G 18: 37,763,449 E524G probably damaging Het
Phlpp1 A T 1: 106,318,993 R638* probably null Het
Pkmyt1 G C 17: 23,735,326 W360S probably benign Het
Plxnd1 C A 6: 115,967,787 probably null Het
Poldip3 A T 15: 83,129,229 N322K probably damaging Het
Prmt3 A T 7: 49,828,947 I419L probably benign Het
Prss36 A T 7: 127,944,830 V123E probably damaging Het
Prss58 A G 6: 40,897,769 I46T probably damaging Het
Rac1 T C 5: 143,506,998 probably benign Het
Rb1cc1 A G 1: 6,233,996 Y36C probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rp1 A T 1: 4,148,703 F951L unknown Het
Rps6ka5 G T 12: 100,575,250 P417T possibly damaging Het
Ryr1 A G 7: 29,067,637 W2967R probably damaging Het
Sacs T A 14: 61,205,543 S1679R probably damaging Het
Scn1a A C 2: 66,335,456 W153G probably damaging Het
Serpinb7 A G 1: 107,445,996 Y114C probably damaging Het
Son T C 16: 91,658,904 M1513T probably benign Het
Spag8 C T 4: 43,651,534 V447M probably benign Het
St3gal2 T A 8: 110,969,553 Y257N probably damaging Het
Tars A T 15: 11,397,196 D40E probably damaging Het
Tlr3 T C 8: 45,397,814 H158R probably benign Het
Tppp2 G T 14: 51,918,935 V50L probably benign Het
Trrap T C 5: 144,810,184 S1503P probably benign Het
Ttll4 T G 1: 74,685,391 S573R probably damaging Het
Vmn2r104 A T 17: 20,029,485 N841K probably damaging Het
Vmn2r3 A T 3: 64,259,647 C688S probably damaging Het
Vps16 T C 2: 130,424,449 probably null Het
Zfp608 G A 18: 54,899,248 T540I probably benign Het
Zfp775 G A 6: 48,619,816 R208Q probably damaging Het
Other mutations in Nwd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Nwd1 APN 8 72671077 missense probably damaging 0.99
IGL01294:Nwd1 APN 8 72711745 missense probably damaging 1.00
IGL01298:Nwd1 APN 8 72662331 missense probably benign 0.00
IGL01333:Nwd1 APN 8 72666811 missense possibly damaging 0.90
IGL01371:Nwd1 APN 8 72675115 missense probably damaging 1.00
IGL02244:Nwd1 APN 8 72707582 missense probably damaging 1.00
IGL02579:Nwd1 APN 8 72707527 missense probably damaging 1.00
IGL02608:Nwd1 APN 8 72667375 missense probably damaging 1.00
IGL02632:Nwd1 APN 8 72667454 missense possibly damaging 0.80
IGL02893:Nwd1 APN 8 72667501 missense probably damaging 1.00
IGL03010:Nwd1 APN 8 72688060 splice site probably benign
R0017:Nwd1 UTSW 8 72709425 splice site probably benign
R0066:Nwd1 UTSW 8 72711856 missense probably benign 0.27
R0066:Nwd1 UTSW 8 72711856 missense probably benign 0.27
R0505:Nwd1 UTSW 8 72662337 missense probably damaging 0.96
R0511:Nwd1 UTSW 8 72682005 missense probably damaging 1.00
R0612:Nwd1 UTSW 8 72667680 missense probably damaging 0.99
R0681:Nwd1 UTSW 8 72662337 missense probably damaging 0.96
R0763:Nwd1 UTSW 8 72671044 missense probably damaging 1.00
R0905:Nwd1 UTSW 8 72709449 missense probably damaging 0.99
R1136:Nwd1 UTSW 8 72697769 splice site probably benign
R1483:Nwd1 UTSW 8 72657086 missense probably damaging 0.96
R1630:Nwd1 UTSW 8 72667029 missense possibly damaging 0.66
R1724:Nwd1 UTSW 8 72711620 missense probably damaging 1.00
R1732:Nwd1 UTSW 8 72666835 missense possibly damaging 0.96
R1885:Nwd1 UTSW 8 72704994 missense probably benign 0.00
R1973:Nwd1 UTSW 8 72704962 missense possibly damaging 0.46
R2393:Nwd1 UTSW 8 72662427 missense probably benign
R2926:Nwd1 UTSW 8 72667012 missense probably damaging 1.00
R3706:Nwd1 UTSW 8 72667116 missense possibly damaging 0.66
R3916:Nwd1 UTSW 8 72667811 nonsense probably null
R3917:Nwd1 UTSW 8 72667811 nonsense probably null
R4153:Nwd1 UTSW 8 72681936 missense probably damaging 1.00
R4426:Nwd1 UTSW 8 72666795 missense probably damaging 1.00
R4435:Nwd1 UTSW 8 72688136 missense possibly damaging 0.46
R4522:Nwd1 UTSW 8 72670951 missense probably damaging 1.00
R4622:Nwd1 UTSW 8 72667300 missense probably damaging 1.00
R4659:Nwd1 UTSW 8 72695321 missense probably benign 0.03
R4694:Nwd1 UTSW 8 72667330 missense probably damaging 1.00
R4837:Nwd1 UTSW 8 72657131 missense probably damaging 1.00
R4844:Nwd1 UTSW 8 72667114 missense probably damaging 1.00
R4906:Nwd1 UTSW 8 72672213 missense probably damaging 1.00
R5041:Nwd1 UTSW 8 72705055 missense possibly damaging 0.90
R5183:Nwd1 UTSW 8 72671086 missense probably benign 0.07
R5416:Nwd1 UTSW 8 72666694 missense possibly damaging 0.90
R5553:Nwd1 UTSW 8 72704976 missense possibly damaging 0.83
R5670:Nwd1 UTSW 8 72693117 missense probably damaging 0.97
R5699:Nwd1 UTSW 8 72702974 critical splice donor site probably null
R5722:Nwd1 UTSW 8 72675244 missense probably damaging 0.97
R5762:Nwd1 UTSW 8 72670914 missense probably damaging 1.00
R5778:Nwd1 UTSW 8 72693117 missense probably damaging 0.97
R6163:Nwd1 UTSW 8 72662186 missense probably damaging 0.96
R6164:Nwd1 UTSW 8 72662186 missense probably damaging 0.96
R6165:Nwd1 UTSW 8 72662186 missense probably damaging 0.96
R6212:Nwd1 UTSW 8 72695322 missense possibly damaging 0.95
R6443:Nwd1 UTSW 8 72662366 missense possibly damaging 0.58
R6865:Nwd1 UTSW 8 72657062 missense possibly damaging 0.63
R6928:Nwd1 UTSW 8 72682025 missense probably benign 0.27
R6944:Nwd1 UTSW 8 72653534 missense possibly damaging 0.69
R6979:Nwd1 UTSW 8 72667660 missense probably damaging 1.00
R7060:Nwd1 UTSW 8 72666694 missense probably damaging 1.00
R7102:Nwd1 UTSW 8 72695329 missense probably damaging 1.00
R7265:Nwd1 UTSW 8 72692928 missense probably benign 0.29
R7343:Nwd1 UTSW 8 72711782 missense probably damaging 0.98
R7391:Nwd1 UTSW 8 72662418 missense probably damaging 0.99
R7424:Nwd1 UTSW 8 72675173 missense possibly damaging 0.86
R7438:Nwd1 UTSW 8 72707830 missense probably benign 0.00
R7487:Nwd1 UTSW 8 72666638 missense unknown
R7502:Nwd1 UTSW 8 72707393 missense probably damaging 0.98
R7883:Nwd1 UTSW 8 72667126 missense probably damaging 1.00
R7966:Nwd1 UTSW 8 72667126 missense probably damaging 1.00
X0067:Nwd1 UTSW 8 72667256 missense possibly damaging 0.81
Z1176:Nwd1 UTSW 8 72672300 missense not run
Z1177:Nwd1 UTSW 8 72666628 missense probably damaging 0.97
Z1177:Nwd1 UTSW 8 72695387 missense possibly damaging 0.48
Z1177:Nwd1 UTSW 8 72709459 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACATTGCAGGGTTCTGATGAAAG -3'
(R):5'- TGTCATCCTATCACTTGGGAGGTC -3'

Sequencing Primer
(F):5'- TTCTGATGAAAGACAGAACACAGTAG -3'
(R):5'- CCTATCACTTGGGAGGTCAACATAG -3'
Posted On2017-06-26