Incidental Mutation 'R5992:Arpp21'
ID480896
Institutional Source Beutler Lab
Gene Symbol Arpp21
Ensembl Gene ENSMUSG00000032503
Gene Namecyclic AMP-regulated phosphoprotein, 21
SynonymsARPP-21, 0710001E13Rik, Tarpp, D9Bwg1012e, R3hdm3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5992 (G1)
Quality Score211.009
Status Not validated
Chromosome9
Chromosomal Location112065091-112235938 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 112143485 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 259 (R259*)
Ref Sequence ENSEMBL: ENSMUSP00000123715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035085] [ENSMUST00000070218] [ENSMUST00000111872] [ENSMUST00000159246] [ENSMUST00000159451] [ENSMUST00000162065] [ENSMUST00000162097] [ENSMUST00000164754]
Predicted Effect probably damaging
Transcript: ENSMUST00000035085
AA Change: E295V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035085
Gene: ENSMUSG00000032503
AA Change: E295V

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
low complexity region 282 297 N/A INTRINSIC
low complexity region 348 368 N/A INTRINSIC
low complexity region 459 482 N/A INTRINSIC
low complexity region 490 503 N/A INTRINSIC
low complexity region 642 657 N/A INTRINSIC
low complexity region 662 674 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000070218
AA Change: E315V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000069264
Gene: ENSMUSG00000032503
AA Change: E315V

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
low complexity region 302 317 N/A INTRINSIC
low complexity region 368 388 N/A INTRINSIC
low complexity region 479 502 N/A INTRINSIC
low complexity region 510 523 N/A INTRINSIC
low complexity region 662 677 N/A INTRINSIC
low complexity region 682 694 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111872
AA Change: E315V

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107503
Gene: ENSMUSG00000032503
AA Change: E315V

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
low complexity region 302 317 N/A INTRINSIC
low complexity region 368 388 N/A INTRINSIC
low complexity region 479 502 N/A INTRINSIC
low complexity region 510 523 N/A INTRINSIC
low complexity region 662 677 N/A INTRINSIC
low complexity region 682 694 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159246
AA Change: R259*
SMART Domains Protein: ENSMUSP00000123715
Gene: ENSMUSG00000032503
AA Change: R259*

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
low complexity region 260 274 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159432
Predicted Effect probably damaging
Transcript: ENSMUST00000159451
AA Change: E246V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125095
Gene: ENSMUSG00000032503
AA Change: E246V

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
low complexity region 233 248 N/A INTRINSIC
low complexity region 299 319 N/A INTRINSIC
low complexity region 410 433 N/A INTRINSIC
low complexity region 558 569 N/A INTRINSIC
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000162065
AA Change: E315V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125684
Gene: ENSMUSG00000032503
AA Change: E315V

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
low complexity region 302 317 N/A INTRINSIC
low complexity region 368 388 N/A INTRINSIC
low complexity region 479 502 N/A INTRINSIC
low complexity region 510 523 N/A INTRINSIC
low complexity region 662 677 N/A INTRINSIC
low complexity region 682 694 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162097
AA Change: E348V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124502
Gene: ENSMUSG00000032503
AA Change: E348V

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
Pfam:SUZ 244 298 3.4e-15 PFAM
low complexity region 335 350 N/A INTRINSIC
low complexity region 401 421 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
low complexity region 660 675 N/A INTRINSIC
low complexity region 680 692 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164754
AA Change: E348V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125862
Gene: ENSMUSG00000032503
AA Change: E348V

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
Pfam:SUZ 244 298 3.4e-15 PFAM
low complexity region 335 350 N/A INTRINSIC
low complexity region 401 421 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
low complexity region 660 675 N/A INTRINSIC
low complexity region 680 692 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cAMP-regulated phosphoprotein. The encoded protein is enriched in the caudate nucleus and cerebellar cortex. A similar protein in mouse may be involved in regulating the effects of dopamine in the basal ganglia. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygous null mice are viable and display normal brain anatomy and no obvious behavioral or morphological defects. However, in medium spiny neurons from mutant mice, the ability of both M1 and D2 receptor activation to modulate L-type calcium channel currents is enhanced by nearly 2-fold. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,508,623 L188* probably null Het
Acod1 C T 14: 103,055,035 R332C probably damaging Het
Adamts3 T A 5: 89,691,335 K852M probably damaging Het
Adm A T 7: 110,627,696 probably benign Het
Aff4 A G 11: 53,373,010 S286G probably damaging Het
Ank2 A G 3: 126,959,651 probably null Het
Aqr A T 2: 114,143,049 Y427* probably null Het
Arid1b C A 17: 4,994,956 probably benign Het
Cep290 C T 10: 100,543,321 A55V possibly damaging Het
Chsy3 GT G 18: 59,176,166 probably null Het
Clcn2 T C 16: 20,713,654 E68G possibly damaging Het
Corin T A 5: 72,316,389 H699L probably benign Het
Cyld T C 8: 88,733,053 Y446H probably damaging Het
Dcst1 T A 3: 89,352,576 E613V probably damaging Het
Dlk1 T C 12: 109,455,581 C74R probably damaging Het
Dnah12 A C 14: 26,697,341 K128T probably benign Het
Dspp T A 5: 104,178,451 S893R unknown Het
Dtl A T 1: 191,568,572 probably null Het
F2rl1 T A 13: 95,514,270 S35C probably benign Het
Fcgbp A T 7: 28,120,534 Y2562F probably benign Het
Fgf10 A T 13: 118,715,508 D42V probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm21190 T A 5: 15,524,851 E256D probably damaging Het
Gm5157 A G 7: 21,185,421 S66P probably damaging Het
Gm884 A T 11: 103,613,792 M2450K possibly damaging Het
Hal T G 10: 93,490,916 L138R probably damaging Het
Hsd17b3 T C 13: 64,059,470 probably null Het
Lrsam1 T C 2: 32,955,222 T94A probably benign Het
Macc1 T C 12: 119,447,585 V696A probably damaging Het
Magi2 G A 5: 19,227,291 M1I probably null Het
March7 C A 2: 60,245,220 N674K probably benign Het
Mfap1b A G 2: 121,470,295 V34A probably benign Het
Mob3b G A 4: 35,084,069 S40L probably benign Het
Ndufs2 A T 1: 171,236,418 V386E probably damaging Het
Nfic C T 10: 81,420,747 A19T probably damaging Het
Nfs1 G A 2: 156,134,453 R174W probably damaging Het
Nin G T 12: 70,045,524 S670R possibly damaging Het
Nrxn1 T C 17: 90,623,507 I754V probably benign Het
Nwd1 T C 8: 72,653,573 probably null Het
Olfr1231 T A 2: 89,303,359 T78S possibly damaging Het
Olfr1238 T A 2: 89,406,879 M67L probably benign Het
Olfr575 G T 7: 102,955,009 N197K probably benign Het
Pcdhgb8 A G 18: 37,763,449 E524G probably damaging Het
Phlpp1 A T 1: 106,318,993 R638* probably null Het
Pkmyt1 G C 17: 23,735,326 W360S probably benign Het
Plxnd1 C A 6: 115,967,787 probably null Het
Poldip3 A T 15: 83,129,229 N322K probably damaging Het
Prmt3 A T 7: 49,828,947 I419L probably benign Het
Prss36 A T 7: 127,944,830 V123E probably damaging Het
Prss58 A G 6: 40,897,769 I46T probably damaging Het
Rac1 T C 5: 143,506,998 probably benign Het
Rb1cc1 A G 1: 6,233,996 Y36C probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rp1 A T 1: 4,148,703 F951L unknown Het
Rps6ka5 G T 12: 100,575,250 P417T possibly damaging Het
Ryr1 A G 7: 29,067,637 W2967R probably damaging Het
Sacs T A 14: 61,205,543 S1679R probably damaging Het
Scn1a A C 2: 66,335,456 W153G probably damaging Het
Serpinb7 A G 1: 107,445,996 Y114C probably damaging Het
Son T C 16: 91,658,904 M1513T probably benign Het
Spag8 C T 4: 43,651,534 V447M probably benign Het
St3gal2 T A 8: 110,969,553 Y257N probably damaging Het
Tars A T 15: 11,397,196 D40E probably damaging Het
Tlr3 T C 8: 45,397,814 H158R probably benign Het
Tppp2 G T 14: 51,918,935 V50L probably benign Het
Trrap T C 5: 144,810,184 S1503P probably benign Het
Ttll4 T G 1: 74,685,391 S573R probably damaging Het
Vmn2r104 A T 17: 20,029,485 N841K probably damaging Het
Vmn2r3 A T 3: 64,259,647 C688S probably damaging Het
Vps16 T C 2: 130,424,449 probably null Het
Zfp608 G A 18: 54,899,248 T540I probably benign Het
Zfp775 G A 6: 48,619,816 R208Q probably damaging Het
Other mutations in Arpp21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Arpp21 APN 9 112176123 missense probably damaging 1.00
IGL02369:Arpp21 APN 9 112119198 missense probably benign
IGL02516:Arpp21 APN 9 112185661 missense probably damaging 1.00
IGL02687:Arpp21 APN 9 112065815 nonsense probably null
IGL02698:Arpp21 APN 9 112185744 utr 5 prime probably benign
IGL02948:Arpp21 APN 9 112176200 missense probably damaging 1.00
R0040:Arpp21 UTSW 9 112147409 splice site probably benign
R0533:Arpp21 UTSW 9 112126505 missense probably benign 0.36
R0636:Arpp21 UTSW 9 112183498 missense probably benign 0.30
R0696:Arpp21 UTSW 9 112183589 splice site probably null
R0707:Arpp21 UTSW 9 112157756 missense probably benign 0.25
R0970:Arpp21 UTSW 9 112136448 splice site probably benign
R1300:Arpp21 UTSW 9 112143374 missense probably damaging 1.00
R1416:Arpp21 UTSW 9 112179129 missense probably damaging 1.00
R1713:Arpp21 UTSW 9 112067169 missense probably damaging 1.00
R1803:Arpp21 UTSW 9 112127398 missense possibly damaging 0.61
R1884:Arpp21 UTSW 9 112143527 missense probably damaging 1.00
R1918:Arpp21 UTSW 9 112119178 splice site probably benign
R1992:Arpp21 UTSW 9 112157793 missense probably damaging 0.97
R2121:Arpp21 UTSW 9 112136670 missense probably damaging 1.00
R2932:Arpp21 UTSW 9 112179105 missense probably damaging 1.00
R3729:Arpp21 UTSW 9 112065979 missense possibly damaging 0.76
R3964:Arpp21 UTSW 9 112065776 missense probably damaging 1.00
R4130:Arpp21 UTSW 9 112155308 intron probably benign
R4131:Arpp21 UTSW 9 112155308 intron probably benign
R4514:Arpp21 UTSW 9 112177677 missense probably damaging 0.99
R4789:Arpp21 UTSW 9 112067292 missense probably benign 0.02
R5138:Arpp21 UTSW 9 112179084 missense probably damaging 1.00
R5218:Arpp21 UTSW 9 112143431 missense probably damaging 1.00
R5371:Arpp21 UTSW 9 112065932 missense probably benign 0.01
R5373:Arpp21 UTSW 9 112067268 missense probably benign
R5407:Arpp21 UTSW 9 112116753 intron probably benign
R5528:Arpp21 UTSW 9 112149353 missense probably benign 0.04
R5957:Arpp21 UTSW 9 112185686 missense probably benign 0.01
R6166:Arpp21 UTSW 9 112119198 missense probably benign
R6294:Arpp21 UTSW 9 112127452 missense probably damaging 0.99
R6632:Arpp21 UTSW 9 112127356 nonsense probably null
R6952:Arpp21 UTSW 9 112126482 missense probably damaging 0.98
R7083:Arpp21 UTSW 9 112183544 missense probably benign 0.22
R7089:Arpp21 UTSW 9 112126446 missense probably benign 0.23
X0013:Arpp21 UTSW 9 112179160 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTTTCCCAGCACTCCTG -3'
(R):5'- AGAGGGATCATGGTGTCTCTAG -3'

Sequencing Primer
(F):5'- CTGGTACTGGACGTGCTG -3'
(R):5'- CCCATGTATAATGTGTGCCATG -3'
Posted On2017-06-26