Incidental Mutation 'R5992:Nfic'
ID480897
Institutional Source Beutler Lab
Gene Symbol Nfic
Ensembl Gene ENSMUSG00000055053
Gene Namenuclear factor I/C
Synonymsnuclear factor 1-C2, 1110019L22Rik, NF1-C, 1500041O16Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.472) question?
Stock #R5992 (G1)
Quality Score140.008
Status Not validated
Chromosome10
Chromosomal Location81396186-81455635 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 81420747 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 19 (A19T)
Ref Sequence ENSEMBL: ENSMUSP00000113046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020461] [ENSMUST00000078185] [ENSMUST00000105321] [ENSMUST00000117966] [ENSMUST00000221817]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020461
AA Change: A28T

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020461
Gene: ENSMUSG00000055053
AA Change: A28T

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 7 47 4.6e-30 PFAM
DWA 68 176 5.77e-24 SMART
Pfam:CTF_NFI 217 428 2e-107 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000078185
AA Change: A28T

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000077317
Gene: ENSMUSG00000055053
AA Change: A28T

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 4 47 9.5e-31 PFAM
DWA 68 176 5.77e-24 SMART
Pfam:CTF_NFI 217 323 1.4e-52 PFAM
Pfam:CTF_NFI 316 387 1.7e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105321
AA Change: A28T

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000100958
Gene: ENSMUSG00000055053
AA Change: A28T

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 4 47 8e-31 PFAM
DWA 68 176 5.77e-24 SMART
Pfam:CTF_NFI 217 426 5.2e-106 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117966
AA Change: A19T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113046
Gene: ENSMUSG00000055053
AA Change: A19T

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 1 38 1.3e-27 PFAM
DWA 59 167 5.77e-24 SMART
Pfam:CTF_NFI 208 421 1.9e-106 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199973
Predicted Effect possibly damaging
Transcript: ENSMUST00000221817
AA Change: A50T

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the CTF/NF-I family. These are dimeric DNA-binding proteins, and function as cellular transcription factors and as replication factors for adenovirus DNA replication. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted null allele have abnormal incisor and molar root development, show reduced alveolar bone formation, and exhibit impaired feeding leading to severe runting and premature death when reared on standard laboratory chow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,508,623 L188* probably null Het
Acod1 C T 14: 103,055,035 R332C probably damaging Het
Adamts3 T A 5: 89,691,335 K852M probably damaging Het
Adm A T 7: 110,627,696 probably benign Het
Aff4 A G 11: 53,373,010 S286G probably damaging Het
Ank2 A G 3: 126,959,651 probably null Het
Aqr A T 2: 114,143,049 Y427* probably null Het
Arid1b C A 17: 4,994,956 probably benign Het
Arpp21 T A 9: 112,143,485 R259* probably null Het
Cep290 C T 10: 100,543,321 A55V possibly damaging Het
Chsy3 GT G 18: 59,176,166 probably null Het
Clcn2 T C 16: 20,713,654 E68G possibly damaging Het
Corin T A 5: 72,316,389 H699L probably benign Het
Cyld T C 8: 88,733,053 Y446H probably damaging Het
Dcst1 T A 3: 89,352,576 E613V probably damaging Het
Dlk1 T C 12: 109,455,581 C74R probably damaging Het
Dnah12 A C 14: 26,697,341 K128T probably benign Het
Dspp T A 5: 104,178,451 S893R unknown Het
Dtl A T 1: 191,568,572 probably null Het
F2rl1 T A 13: 95,514,270 S35C probably benign Het
Fcgbp A T 7: 28,120,534 Y2562F probably benign Het
Fgf10 A T 13: 118,715,508 D42V probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm21190 T A 5: 15,524,851 E256D probably damaging Het
Gm5157 A G 7: 21,185,421 S66P probably damaging Het
Gm884 A T 11: 103,613,792 M2450K possibly damaging Het
Hal T G 10: 93,490,916 L138R probably damaging Het
Hsd17b3 T C 13: 64,059,470 probably null Het
Lrsam1 T C 2: 32,955,222 T94A probably benign Het
Macc1 T C 12: 119,447,585 V696A probably damaging Het
Magi2 G A 5: 19,227,291 M1I probably null Het
March7 C A 2: 60,245,220 N674K probably benign Het
Mfap1b A G 2: 121,470,295 V34A probably benign Het
Mob3b G A 4: 35,084,069 S40L probably benign Het
Ndufs2 A T 1: 171,236,418 V386E probably damaging Het
Nfs1 G A 2: 156,134,453 R174W probably damaging Het
Nin G T 12: 70,045,524 S670R possibly damaging Het
Nrxn1 T C 17: 90,623,507 I754V probably benign Het
Nwd1 T C 8: 72,653,573 probably null Het
Olfr1231 T A 2: 89,303,359 T78S possibly damaging Het
Olfr1238 T A 2: 89,406,879 M67L probably benign Het
Olfr575 G T 7: 102,955,009 N197K probably benign Het
Pcdhgb8 A G 18: 37,763,449 E524G probably damaging Het
Phlpp1 A T 1: 106,318,993 R638* probably null Het
Pkmyt1 G C 17: 23,735,326 W360S probably benign Het
Plxnd1 C A 6: 115,967,787 probably null Het
Poldip3 A T 15: 83,129,229 N322K probably damaging Het
Prmt3 A T 7: 49,828,947 I419L probably benign Het
Prss36 A T 7: 127,944,830 V123E probably damaging Het
Prss58 A G 6: 40,897,769 I46T probably damaging Het
Rac1 T C 5: 143,506,998 probably benign Het
Rb1cc1 A G 1: 6,233,996 Y36C probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rp1 A T 1: 4,148,703 F951L unknown Het
Rps6ka5 G T 12: 100,575,250 P417T possibly damaging Het
Ryr1 A G 7: 29,067,637 W2967R probably damaging Het
Sacs T A 14: 61,205,543 S1679R probably damaging Het
Scn1a A C 2: 66,335,456 W153G probably damaging Het
Serpinb7 A G 1: 107,445,996 Y114C probably damaging Het
Son T C 16: 91,658,904 M1513T probably benign Het
Spag8 C T 4: 43,651,534 V447M probably benign Het
St3gal2 T A 8: 110,969,553 Y257N probably damaging Het
Tars A T 15: 11,397,196 D40E probably damaging Het
Tlr3 T C 8: 45,397,814 H158R probably benign Het
Tppp2 G T 14: 51,918,935 V50L probably benign Het
Trrap T C 5: 144,810,184 S1503P probably benign Het
Ttll4 T G 1: 74,685,391 S573R probably damaging Het
Vmn2r104 A T 17: 20,029,485 N841K probably damaging Het
Vmn2r3 A T 3: 64,259,647 C688S probably damaging Het
Vps16 T C 2: 130,424,449 probably null Het
Zfp608 G A 18: 54,899,248 T540I probably benign Het
Zfp775 G A 6: 48,619,816 R208Q probably damaging Het
Other mutations in Nfic
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Nfic APN 10 81408220 missense possibly damaging 0.94
IGL01486:Nfic APN 10 81407644 unclassified probably null
IGL01784:Nfic APN 10 81406148 missense possibly damaging 0.70
IGL02053:Nfic APN 10 81420551 missense probably damaging 1.00
IGL03128:Nfic APN 10 81406191 missense probably benign 0.21
sterb UTSW 10 81420800 critical splice acceptor site probably null
R0113:Nfic UTSW 10 81420585 missense probably damaging 1.00
R1468:Nfic UTSW 10 81420580 missense probably damaging 1.00
R1468:Nfic UTSW 10 81420580 missense probably damaging 1.00
R1807:Nfic UTSW 10 81404985 missense probably benign 0.21
R1872:Nfic UTSW 10 81420684 missense possibly damaging 0.89
R2295:Nfic UTSW 10 81420531 missense probably damaging 1.00
R2324:Nfic UTSW 10 81406087 critical splice donor site probably null
R6260:Nfic UTSW 10 81420517 nonsense probably null
R6972:Nfic UTSW 10 81420357 missense probably benign 0.00
R6973:Nfic UTSW 10 81420357 missense probably benign 0.00
R6982:Nfic UTSW 10 81420800 critical splice acceptor site probably null
R7158:Nfic UTSW 10 81420605 missense probably damaging 1.00
R7682:Nfic UTSW 10 81420500 missense probably damaging 1.00
X0065:Nfic UTSW 10 81427098 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGTACGAAGTCTTCACGGCAC -3'
(R):5'- CAGTTTCCTTATGTGGGCAACAG -3'

Sequencing Primer
(F):5'- AAGTCTTCACGGCACTCGGG -3'
(R):5'- GCAACAGGCCTGAGTTTACAG -3'
Posted On2017-06-26