Incidental Mutation 'R5992:Cep290'
ID480899
Institutional Source Beutler Lab
Gene Symbol Cep290
Ensembl Gene ENSMUSG00000019971
Gene Namecentrosomal protein 290
Synonymsb2b1454Clo, Nphp6, b2b1752Clo
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.903) question?
Stock #R5992 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location100487558-100574840 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 100543321 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 55 (A55V)
Ref Sequence ENSEMBL: ENSMUSP00000151414 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164751] [ENSMUST00000219408] [ENSMUST00000219765] [ENSMUST00000220346]
Predicted Effect probably benign
Transcript: ENSMUST00000164751
AA Change: A1632V

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000130899
Gene: ENSMUSG00000019971
AA Change: A1632V

DomainStartEndE-ValueType
coiled coil region 59 298 N/A INTRINSIC
coiled coil region 319 566 N/A INTRINSIC
coiled coil region 598 662 N/A INTRINSIC
coiled coil region 697 754 N/A INTRINSIC
coiled coil region 780 875 N/A INTRINSIC
internal_repeat_2 884 894 1.1e-5 PROSPERO
coiled coil region 986 1028 N/A INTRINSIC
internal_repeat_2 1057 1067 1.1e-5 PROSPERO
coiled coil region 1071 1109 N/A INTRINSIC
low complexity region 1140 1156 N/A INTRINSIC
internal_repeat_1 1176 1206 8.72e-8 PROSPERO
coiled coil region 1221 1250 N/A INTRINSIC
Pfam:CEP209_CC5 1290 1417 3.8e-55 PFAM
low complexity region 1476 1493 N/A INTRINSIC
internal_repeat_1 1498 1525 8.72e-8 PROSPERO
coiled coil region 1535 1595 N/A INTRINSIC
coiled coil region 1624 1716 N/A INTRINSIC
coiled coil region 1776 2328 N/A INTRINSIC
low complexity region 2333 2347 N/A INTRINSIC
coiled coil region 2377 2453 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218703
Predicted Effect possibly damaging
Transcript: ENSMUST00000219408
AA Change: A55V

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219643
Predicted Effect probably benign
Transcript: ENSMUST00000219765
AA Change: A1625V

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000220346
AA Change: A1632V

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 13 putative coiled-coil domains, a region with homology to SMC chromosome segregation ATPases, six KID motifs, three tropomyosin homology domains and an ATP/GTP binding site motif A. The protein is localized to the centrosome and cilia and has sites for N-glycosylation, tyrosine sulfation, phosphorylation, N-myristoylation, and amidation. Mutations in this gene have been associated with Joubert syndrome and nephronophthisis and the presence of antibodies against this protein is associated with several forms of cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice display mislocalization of ciliary and phototransduction proteins resulting in early-onset retinal degeneration. Heterotaxy with transposition of the great arteries (TGA), atrioventricular septal defect (AVSD), left bronchial isomerism, and hypoplastic spleen is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,508,623 L188* probably null Het
Acod1 C T 14: 103,055,035 R332C probably damaging Het
Adamts3 T A 5: 89,691,335 K852M probably damaging Het
Adm A T 7: 110,627,696 probably benign Het
Aff4 A G 11: 53,373,010 S286G probably damaging Het
Ank2 A G 3: 126,959,651 probably null Het
Aqr A T 2: 114,143,049 Y427* probably null Het
Arid1b C A 17: 4,994,956 probably benign Het
Arpp21 T A 9: 112,143,485 R259* probably null Het
Chsy3 GT G 18: 59,176,166 probably null Het
Clcn2 T C 16: 20,713,654 E68G possibly damaging Het
Corin T A 5: 72,316,389 H699L probably benign Het
Cyld T C 8: 88,733,053 Y446H probably damaging Het
Dcst1 T A 3: 89,352,576 E613V probably damaging Het
Dlk1 T C 12: 109,455,581 C74R probably damaging Het
Dnah12 A C 14: 26,697,341 K128T probably benign Het
Dspp T A 5: 104,178,451 S893R unknown Het
Dtl A T 1: 191,568,572 probably null Het
F2rl1 T A 13: 95,514,270 S35C probably benign Het
Fcgbp A T 7: 28,120,534 Y2562F probably benign Het
Fgf10 A T 13: 118,715,508 D42V probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm21190 T A 5: 15,524,851 E256D probably damaging Het
Gm5157 A G 7: 21,185,421 S66P probably damaging Het
Gm884 A T 11: 103,613,792 M2450K possibly damaging Het
Hal T G 10: 93,490,916 L138R probably damaging Het
Hsd17b3 T C 13: 64,059,470 probably null Het
Lrsam1 T C 2: 32,955,222 T94A probably benign Het
Macc1 T C 12: 119,447,585 V696A probably damaging Het
Magi2 G A 5: 19,227,291 M1I probably null Het
March7 C A 2: 60,245,220 N674K probably benign Het
Mfap1b A G 2: 121,470,295 V34A probably benign Het
Mob3b G A 4: 35,084,069 S40L probably benign Het
Ndufs2 A T 1: 171,236,418 V386E probably damaging Het
Nfic C T 10: 81,420,747 A19T probably damaging Het
Nfs1 G A 2: 156,134,453 R174W probably damaging Het
Nin G T 12: 70,045,524 S670R possibly damaging Het
Nrxn1 T C 17: 90,623,507 I754V probably benign Het
Nwd1 T C 8: 72,653,573 probably null Het
Olfr1231 T A 2: 89,303,359 T78S possibly damaging Het
Olfr1238 T A 2: 89,406,879 M67L probably benign Het
Olfr575 G T 7: 102,955,009 N197K probably benign Het
Pcdhgb8 A G 18: 37,763,449 E524G probably damaging Het
Phlpp1 A T 1: 106,318,993 R638* probably null Het
Pkmyt1 G C 17: 23,735,326 W360S probably benign Het
Plxnd1 C A 6: 115,967,787 probably null Het
Poldip3 A T 15: 83,129,229 N322K probably damaging Het
Prmt3 A T 7: 49,828,947 I419L probably benign Het
Prss36 A T 7: 127,944,830 V123E probably damaging Het
Prss58 A G 6: 40,897,769 I46T probably damaging Het
Rac1 T C 5: 143,506,998 probably benign Het
Rb1cc1 A G 1: 6,233,996 Y36C probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rp1 A T 1: 4,148,703 F951L unknown Het
Rps6ka5 G T 12: 100,575,250 P417T possibly damaging Het
Ryr1 A G 7: 29,067,637 W2967R probably damaging Het
Sacs T A 14: 61,205,543 S1679R probably damaging Het
Scn1a A C 2: 66,335,456 W153G probably damaging Het
Serpinb7 A G 1: 107,445,996 Y114C probably damaging Het
Son T C 16: 91,658,904 M1513T probably benign Het
Spag8 C T 4: 43,651,534 V447M probably benign Het
St3gal2 T A 8: 110,969,553 Y257N probably damaging Het
Tars A T 15: 11,397,196 D40E probably damaging Het
Tlr3 T C 8: 45,397,814 H158R probably benign Het
Tppp2 G T 14: 51,918,935 V50L probably benign Het
Trrap T C 5: 144,810,184 S1503P probably benign Het
Ttll4 T G 1: 74,685,391 S573R probably damaging Het
Vmn2r104 A T 17: 20,029,485 N841K probably damaging Het
Vmn2r3 A T 3: 64,259,647 C688S probably damaging Het
Vps16 T C 2: 130,424,449 probably null Het
Zfp608 G A 18: 54,899,248 T540I probably benign Het
Zfp775 G A 6: 48,619,816 R208Q probably damaging Het
Other mutations in Cep290
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Cep290 APN 10 100508724 missense probably benign 0.00
IGL00499:Cep290 APN 10 100543327 missense probably damaging 1.00
IGL00547:Cep290 APN 10 100510708 missense probably damaging 0.99
IGL00573:Cep290 APN 10 100540361 missense probably damaging 1.00
IGL00646:Cep290 APN 10 100501154 missense probably benign 0.15
IGL00755:Cep290 APN 10 100531104 missense probably damaging 1.00
IGL00835:Cep290 APN 10 100563380 nonsense probably null
IGL00846:Cep290 APN 10 100540333 splice site probably benign
IGL00985:Cep290 APN 10 100567161 splice site probably benign
IGL01687:Cep290 APN 10 100500205 missense probably damaging 1.00
IGL01782:Cep290 APN 10 100545125 nonsense probably null
IGL02010:Cep290 APN 10 100508707 missense probably benign 0.39
IGL02010:Cep290 APN 10 100561345 missense probably benign 0.00
IGL02036:Cep290 APN 10 100558100 nonsense probably null
IGL02039:Cep290 APN 10 100514602 critical splice donor site probably null
IGL02532:Cep290 APN 10 100545065 missense probably benign 0.04
IGL02950:Cep290 APN 10 100540329 splice site probably benign
IGL03105:Cep290 APN 10 100551824 missense possibly damaging 0.66
IGL03179:Cep290 APN 10 100568088 missense possibly damaging 0.60
IGL03271:Cep290 APN 10 100537801 missense probably benign 0.09
IGL03401:Cep290 APN 10 100500265 missense probably benign 0.27
PIT4687001:Cep290 UTSW 10 100537591 missense probably benign 0.28
R0025:Cep290 UTSW 10 100537831 missense probably damaging 1.00
R0127:Cep290 UTSW 10 100536925 splice site probably benign
R0254:Cep290 UTSW 10 100514574 missense probably benign 0.31
R0295:Cep290 UTSW 10 100537821 missense probably damaging 0.99
R0371:Cep290 UTSW 10 100518564 splice site probably benign
R0390:Cep290 UTSW 10 100508758 missense probably benign 0.09
R0399:Cep290 UTSW 10 100554400 splice site probably benign
R0413:Cep290 UTSW 10 100523314 nonsense probably null
R0427:Cep290 UTSW 10 100516179 missense probably benign 0.01
R0472:Cep290 UTSW 10 100551455 missense probably benign 0.19
R0485:Cep290 UTSW 10 100549344 missense possibly damaging 0.94
R0635:Cep290 UTSW 10 100492676 missense probably damaging 1.00
R0675:Cep290 UTSW 10 100568813 critical splice acceptor site probably null
R0972:Cep290 UTSW 10 100518762 missense probably benign 0.08
R1238:Cep290 UTSW 10 100517863 missense probably damaging 1.00
R1297:Cep290 UTSW 10 100539100 splice site probably benign
R1368:Cep290 UTSW 10 100494966 splice site probably benign
R1394:Cep290 UTSW 10 100537529 missense possibly damaging 0.66
R1437:Cep290 UTSW 10 100572101 missense probably benign 0.00
R1493:Cep290 UTSW 10 100562181 missense probably benign 0.21
R1496:Cep290 UTSW 10 100538966 missense probably damaging 1.00
R1539:Cep290 UTSW 10 100496828 missense probably benign 0.06
R1598:Cep290 UTSW 10 100549329 missense probably damaging 1.00
R1616:Cep290 UTSW 10 100568836 missense probably benign
R1712:Cep290 UTSW 10 100554499 missense probably benign 0.02
R1753:Cep290 UTSW 10 100513981 missense probably benign
R1773:Cep290 UTSW 10 100510573 missense probably benign
R1775:Cep290 UTSW 10 100496810 missense probably damaging 0.98
R1799:Cep290 UTSW 10 100516196 missense probably benign 0.00
R1937:Cep290 UTSW 10 100497953 missense possibly damaging 0.71
R1991:Cep290 UTSW 10 100531184 missense possibly damaging 0.80
R2031:Cep290 UTSW 10 100512400 critical splice donor site probably null
R2164:Cep290 UTSW 10 100518795 missense probably damaging 0.96
R2393:Cep290 UTSW 10 100561238 critical splice acceptor site probably null
R2403:Cep290 UTSW 10 100537437 missense probably benign 0.19
R3612:Cep290 UTSW 10 100541581 nonsense probably null
R3800:Cep290 UTSW 10 100572941 missense probably damaging 0.97
R4005:Cep290 UTSW 10 100539008 missense probably damaging 1.00
R4039:Cep290 UTSW 10 100512401 critical splice donor site probably null
R4259:Cep290 UTSW 10 100514492 missense probably damaging 1.00
R4260:Cep290 UTSW 10 100514492 missense probably damaging 1.00
R4319:Cep290 UTSW 10 100539047 missense probably benign 0.09
R4329:Cep290 UTSW 10 100537668 missense probably damaging 0.98
R4573:Cep290 UTSW 10 100518850 missense probably benign
R4614:Cep290 UTSW 10 100508740 missense probably benign
R4614:Cep290 UTSW 10 100559687 missense possibly damaging 0.93
R4708:Cep290 UTSW 10 100523264 missense probably benign 0.02
R4727:Cep290 UTSW 10 100563270 missense probably benign 0.05
R4825:Cep290 UTSW 10 100488348 missense probably damaging 0.96
R4839:Cep290 UTSW 10 100508786 missense probably damaging 0.99
R4858:Cep290 UTSW 10 100494911 missense probably benign 0.31
R4871:Cep290 UTSW 10 100548914 missense probably benign 0.22
R5094:Cep290 UTSW 10 100567030 missense probably damaging 0.97
R5103:Cep290 UTSW 10 100539020 missense probably damaging 1.00
R5499:Cep290 UTSW 10 100537653 missense probably damaging 0.99
R5505:Cep290 UTSW 10 100499186 critical splice donor site probably null
R5615:Cep290 UTSW 10 100531150 missense probably damaging 1.00
R5815:Cep290 UTSW 10 100558108 missense possibly damaging 0.80
R5883:Cep290 UTSW 10 100523399 missense probably benign 0.44
R5889:Cep290 UTSW 10 100499074 missense possibly damaging 0.95
R5928:Cep290 UTSW 10 100551830 missense probably damaging 0.99
R6000:Cep290 UTSW 10 100541787 missense probably damaging 1.00
R6213:Cep290 UTSW 10 100523360 missense probably benign 0.06
R6274:Cep290 UTSW 10 100530207 missense probably damaging 1.00
R6285:Cep290 UTSW 10 100523329 missense probably benign 0.17
R6306:Cep290 UTSW 10 100531166 missense possibly damaging 0.89
R6593:Cep290 UTSW 10 100508776 missense probably benign 0.01
R6649:Cep290 UTSW 10 100518531 missense probably benign 0.28
R6692:Cep290 UTSW 10 100569144 intron probably null
R6788:Cep290 UTSW 10 100488628 missense probably damaging 1.00
R6847:Cep290 UTSW 10 100563419 missense probably damaging 1.00
R6947:Cep290 UTSW 10 100530056 missense probably damaging 1.00
R7035:Cep290 UTSW 10 100499071 missense probably benign 0.07
R7073:Cep290 UTSW 10 100539003 missense possibly damaging 0.90
R7114:Cep290 UTSW 10 100543358 missense probably damaging 0.98
R7256:Cep290 UTSW 10 100546498 missense probably damaging 1.00
R7258:Cep290 UTSW 10 100499108 missense probably benign 0.01
R7311:Cep290 UTSW 10 100537718 missense probably damaging 0.98
R7505:Cep290 UTSW 10 100516265 missense probably benign 0.01
R7615:Cep290 UTSW 10 100492681 missense probably benign 0.03
R7643:Cep290 UTSW 10 100537553 missense probably benign
R7662:Cep290 UTSW 10 100537803 missense probably benign 0.21
R7663:Cep290 UTSW 10 100554536 critical splice donor site probably null
R7685:Cep290 UTSW 10 100540057 missense probably benign 0.19
R7717:Cep290 UTSW 10 100492681 missense probably benign 0.03
R7747:Cep290 UTSW 10 100558176 nonsense probably null
R7757:Cep290 UTSW 10 100563434 missense probably benign
R7843:Cep290 UTSW 10 100516188 missense possibly damaging 0.49
R7905:Cep290 UTSW 10 100554490 missense probably benign
R7926:Cep290 UTSW 10 100516188 missense possibly damaging 0.49
R7988:Cep290 UTSW 10 100554490 missense probably benign
Z1176:Cep290 UTSW 10 100549374 critical splice donor site probably benign
Z1177:Cep290 UTSW 10 100497944 missense probably benign
Z1177:Cep290 UTSW 10 100538997 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGCTCATAACCGTGCATTGC -3'
(R):5'- CAGCAGGTACAAGCTTTATCATAGC -3'

Sequencing Primer
(F):5'- TGCATTGCACTTAGACACTGAC -3'
(R):5'- ACAAGCTTTATCATAGCATAACTTCC -3'
Posted On2017-06-26