Incidental Mutation 'R5992:Nin'
ID 480904
Institutional Source Beutler Lab
Gene Symbol Nin
Ensembl Gene ENSMUSG00000021068
Gene Name ninein
Synonyms 3110068G20Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5992 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 70058209-70160491 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 70092298 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 670 (S670R)
Ref Sequence ENSEMBL: ENSMUSP00000152530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021468] [ENSMUST00000085314] [ENSMUST00000095666] [ENSMUST00000169074] [ENSMUST00000220689] [ENSMUST00000222237] [ENSMUST00000222835] [ENSMUST00000223257]
AlphaFold Q61043
Predicted Effect probably benign
Transcript: ENSMUST00000021468
AA Change: S670R

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000021468
Gene: ENSMUSG00000021068
AA Change: S670R

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085314
AA Change: S670R

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000082422
Gene: ENSMUSG00000021068
AA Change: S670R

DomainStartEndE-ValueType
internal_repeat_1 7 67 4.15e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 4.15e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1971 2045 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095666
AA Change: S670R

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000093327
Gene: ENSMUSG00000021068
AA Change: S670R

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169074
AA Change: S670R

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000129648
Gene: ENSMUSG00000021068
AA Change: S670R

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000220689
AA Change: S670R

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221486
Predicted Effect probably benign
Transcript: ENSMUST00000222237
AA Change: S670R

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000222835
AA Change: S670R

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000223257
AA Change: S670R

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223316
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the proteins important for centrosomal function. This protein is important for positioning and anchoring the microtubules minus-ends in epithelial cells. Localization of this protein to the centrosome requires three leucine zippers in the central coiled-coil domain. Multiple alternatively spliced transcript variants that encode different isoforms have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,819,549 (GRCm39) L188* probably null Het
Acod1 C T 14: 103,292,471 (GRCm39) R332C probably damaging Het
Adamts3 T A 5: 89,839,194 (GRCm39) K852M probably damaging Het
Adm A T 7: 110,226,903 (GRCm39) probably benign Het
Aff4 A G 11: 53,263,837 (GRCm39) S286G probably damaging Het
Ank2 A G 3: 126,753,300 (GRCm39) probably null Het
Aqr A T 2: 113,973,530 (GRCm39) Y427* probably null Het
Arid1b C A 17: 5,045,231 (GRCm39) probably benign Het
Arpp21 T A 9: 111,972,553 (GRCm39) R259* probably null Het
Cep290 C T 10: 100,379,183 (GRCm39) A55V possibly damaging Het
Chsy3 GT G 18: 59,309,238 (GRCm39) 163 probably null Het
Clcn2 T C 16: 20,532,404 (GRCm39) E68G possibly damaging Het
Corin T A 5: 72,473,732 (GRCm39) H699L probably benign Het
Cyld T C 8: 89,459,681 (GRCm39) Y446H probably damaging Het
Dcst1 T A 3: 89,259,883 (GRCm39) E613V probably damaging Het
Dlk1 T C 12: 109,421,507 (GRCm39) C74R probably damaging Het
Dnah12 A C 14: 26,418,496 (GRCm39) K128T probably benign Het
Dspp T A 5: 104,326,317 (GRCm39) S893R unknown Het
Dtl A T 1: 191,300,684 (GRCm39) probably null Het
F2rl1 T A 13: 95,650,778 (GRCm39) S35C probably benign Het
Fcgbp A T 7: 27,819,959 (GRCm39) Y2562F probably benign Het
Fgf10 A T 13: 118,852,044 (GRCm39) D42V probably benign Het
Gm10271 A T 10: 116,808,497 (GRCm39) F6L probably damaging Het
Gm21190 T A 5: 15,729,849 (GRCm39) E256D probably damaging Het
Gm5157 A G 7: 20,919,346 (GRCm39) S66P probably damaging Het
Hal T G 10: 93,326,778 (GRCm39) L138R probably damaging Het
Hsd17b3 T C 13: 64,207,284 (GRCm39) probably null Het
Lrrc37 A T 11: 103,504,618 (GRCm39) M2450K possibly damaging Het
Lrsam1 T C 2: 32,845,234 (GRCm39) T94A probably benign Het
Macc1 T C 12: 119,411,320 (GRCm39) V696A probably damaging Het
Magi2 G A 5: 19,432,289 (GRCm39) M1I probably null Het
Marchf7 C A 2: 60,075,564 (GRCm39) N674K probably benign Het
Mfap1b A G 2: 121,300,776 (GRCm39) V34A probably benign Het
Mob3b G A 4: 35,084,069 (GRCm39) S40L probably benign Het
Ndufs2 A T 1: 171,063,987 (GRCm39) V386E probably damaging Het
Nfic C T 10: 81,256,581 (GRCm39) A19T probably damaging Het
Nfs1 G A 2: 155,976,373 (GRCm39) R174W probably damaging Het
Nrxn1 T C 17: 90,930,935 (GRCm39) I754V probably benign Het
Nwd1 T C 8: 73,380,201 (GRCm39) probably null Het
Or4a39 T A 2: 89,237,223 (GRCm39) M67L probably benign Het
Or4c1 T A 2: 89,133,703 (GRCm39) T78S possibly damaging Het
Or51a6 G T 7: 102,604,216 (GRCm39) N197K probably benign Het
Pcdhgb8 A G 18: 37,896,502 (GRCm39) E524G probably damaging Het
Phlpp1 A T 1: 106,246,723 (GRCm39) R638* probably null Het
Pkmyt1 G C 17: 23,954,300 (GRCm39) W360S probably benign Het
Plxnd1 C A 6: 115,944,748 (GRCm39) probably null Het
Poldip3 A T 15: 83,013,430 (GRCm39) N322K probably damaging Het
Prmt3 A T 7: 49,478,695 (GRCm39) I419L probably benign Het
Prss36 A T 7: 127,544,002 (GRCm39) V123E probably damaging Het
Prss58 A G 6: 40,874,703 (GRCm39) I46T probably damaging Het
Rac1 T C 5: 143,492,753 (GRCm39) probably benign Het
Rb1cc1 A G 1: 6,304,220 (GRCm39) Y36C probably damaging Het
Rif1 C G 2: 51,985,856 (GRCm39) L614V probably damaging Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Rp1 A T 1: 4,218,926 (GRCm39) F951L unknown Het
Rps6ka5 G T 12: 100,541,509 (GRCm39) P417T possibly damaging Het
Ryr1 A G 7: 28,767,062 (GRCm39) W2967R probably damaging Het
Sacs T A 14: 61,442,992 (GRCm39) S1679R probably damaging Het
Scn1a A C 2: 66,165,800 (GRCm39) W153G probably damaging Het
Serpinb7 A G 1: 107,373,726 (GRCm39) Y114C probably damaging Het
Son T C 16: 91,455,792 (GRCm39) M1513T probably benign Het
Spag8 C T 4: 43,651,534 (GRCm39) V447M probably benign Het
St3gal2 T A 8: 111,696,185 (GRCm39) Y257N probably damaging Het
Tars1 A T 15: 11,397,282 (GRCm39) D40E probably damaging Het
Tlr3 T C 8: 45,850,851 (GRCm39) H158R probably benign Het
Tppp2 G T 14: 52,156,392 (GRCm39) V50L probably benign Het
Trrap T C 5: 144,746,994 (GRCm39) S1503P probably benign Het
Ttll4 T G 1: 74,724,550 (GRCm39) S573R probably damaging Het
Vmn2r104 A T 17: 20,249,747 (GRCm39) N841K probably damaging Het
Vmn2r3 A T 3: 64,167,068 (GRCm39) C688S probably damaging Het
Vps16 T C 2: 130,266,369 (GRCm39) probably null Het
Zfp608 G A 18: 55,032,320 (GRCm39) T540I probably benign Het
Zfp775 G A 6: 48,596,750 (GRCm39) R208Q probably damaging Het
Other mutations in Nin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Nin APN 12 70,076,862 (GRCm39) missense probably damaging 0.98
IGL00677:Nin APN 12 70,073,634 (GRCm39) missense probably damaging 1.00
IGL00823:Nin APN 12 70,061,567 (GRCm39) missense probably benign 0.01
IGL01103:Nin APN 12 70,103,532 (GRCm39) missense probably damaging 0.99
IGL01113:Nin APN 12 70,078,553 (GRCm39) missense probably damaging 1.00
IGL01420:Nin APN 12 70,092,188 (GRCm39) missense probably benign 0.08
IGL01556:Nin APN 12 70,089,962 (GRCm39) missense probably benign 0.01
IGL01663:Nin APN 12 70,090,439 (GRCm39) missense possibly damaging 0.72
IGL02002:Nin APN 12 70,109,473 (GRCm39) nonsense probably null
IGL02030:Nin APN 12 70,092,042 (GRCm39) missense probably damaging 1.00
IGL02202:Nin APN 12 70,102,210 (GRCm39) missense probably damaging 1.00
IGL02207:Nin APN 12 70,103,431 (GRCm39) missense probably damaging 0.99
IGL02257:Nin APN 12 70,149,465 (GRCm39) missense possibly damaging 0.71
IGL02394:Nin APN 12 70,090,805 (GRCm39) missense probably damaging 1.00
IGL02531:Nin APN 12 70,067,706 (GRCm39) missense probably benign 0.02
IGL03028:Nin APN 12 70,082,044 (GRCm39) missense probably benign 0.13
IGL03155:Nin APN 12 70,078,544 (GRCm39) missense probably damaging 1.00
IGL03197:Nin APN 12 70,073,584 (GRCm39) missense probably benign 0.03
IGL02835:Nin UTSW 12 70,103,512 (GRCm39) missense probably damaging 1.00
R0131:Nin UTSW 12 70,097,915 (GRCm39) missense probably damaging 1.00
R0131:Nin UTSW 12 70,097,915 (GRCm39) missense probably damaging 1.00
R0132:Nin UTSW 12 70,097,915 (GRCm39) missense probably damaging 1.00
R0211:Nin UTSW 12 70,061,649 (GRCm39) missense probably damaging 1.00
R0211:Nin UTSW 12 70,061,649 (GRCm39) missense probably damaging 1.00
R0734:Nin UTSW 12 70,076,887 (GRCm39) missense probably benign 0.01
R0947:Nin UTSW 12 70,107,960 (GRCm39) missense probably damaging 1.00
R1085:Nin UTSW 12 70,067,736 (GRCm39) missense possibly damaging 0.91
R1367:Nin UTSW 12 70,090,703 (GRCm39) missense probably damaging 0.99
R1452:Nin UTSW 12 70,064,424 (GRCm39) nonsense probably null
R1477:Nin UTSW 12 70,090,958 (GRCm39) missense possibly damaging 0.87
R1518:Nin UTSW 12 70,061,547 (GRCm39) missense probably benign 0.27
R1566:Nin UTSW 12 70,101,253 (GRCm39) missense probably damaging 0.99
R1572:Nin UTSW 12 70,085,524 (GRCm39) missense probably damaging 1.00
R1583:Nin UTSW 12 70,078,512 (GRCm39) missense probably benign
R1584:Nin UTSW 12 70,089,443 (GRCm39) missense probably benign 0.03
R1699:Nin UTSW 12 70,092,337 (GRCm39) missense possibly damaging 0.87
R1699:Nin UTSW 12 70,077,712 (GRCm39) missense probably benign 0.40
R1765:Nin UTSW 12 70,089,665 (GRCm39) missense probably damaging 1.00
R1794:Nin UTSW 12 70,090,569 (GRCm39) nonsense probably null
R1952:Nin UTSW 12 70,077,700 (GRCm39) missense probably damaging 1.00
R2004:Nin UTSW 12 70,072,251 (GRCm39) missense probably benign 0.01
R2025:Nin UTSW 12 70,076,782 (GRCm39) missense probably damaging 1.00
R2060:Nin UTSW 12 70,089,192 (GRCm39) missense possibly damaging 0.64
R2213:Nin UTSW 12 70,092,128 (GRCm39) missense probably damaging 1.00
R2224:Nin UTSW 12 70,108,004 (GRCm39) missense probably damaging 1.00
R2247:Nin UTSW 12 70,101,319 (GRCm39) missense probably damaging 1.00
R2972:Nin UTSW 12 70,109,487 (GRCm39) missense probably damaging 1.00
R3776:Nin UTSW 12 70,085,456 (GRCm39) missense possibly damaging 0.71
R3881:Nin UTSW 12 70,089,315 (GRCm39) missense probably benign 0.00
R3930:Nin UTSW 12 70,125,016 (GRCm39) missense probably damaging 1.00
R3959:Nin UTSW 12 70,097,526 (GRCm39) missense probably damaging 1.00
R4229:Nin UTSW 12 70,097,984 (GRCm39) missense probably damaging 0.99
R4359:Nin UTSW 12 70,061,712 (GRCm39) missense probably benign 0.00
R4423:Nin UTSW 12 70,089,752 (GRCm39) missense probably damaging 1.00
R4461:Nin UTSW 12 70,089,359 (GRCm39) missense probably benign 0.37
R4639:Nin UTSW 12 70,085,375 (GRCm39) missense probably damaging 0.97
R4791:Nin UTSW 12 70,090,581 (GRCm39) missense possibly damaging 0.94
R4839:Nin UTSW 12 70,137,325 (GRCm39) missense possibly damaging 0.46
R4912:Nin UTSW 12 70,090,837 (GRCm39) missense probably damaging 1.00
R5712:Nin UTSW 12 70,089,543 (GRCm39) missense probably damaging 1.00
R5726:Nin UTSW 12 70,124,953 (GRCm39) missense probably damaging 1.00
R5804:Nin UTSW 12 70,092,375 (GRCm39) missense possibly damaging 0.58
R5874:Nin UTSW 12 70,077,692 (GRCm39) missense possibly damaging 0.94
R6077:Nin UTSW 12 70,066,006 (GRCm39) missense probably damaging 1.00
R6184:Nin UTSW 12 70,090,511 (GRCm39) missense probably damaging 1.00
R6307:Nin UTSW 12 70,061,631 (GRCm39) missense possibly damaging 0.91
R6315:Nin UTSW 12 70,092,389 (GRCm39) missense probably damaging 1.00
R6326:Nin UTSW 12 70,091,955 (GRCm39) missense possibly damaging 0.95
R6492:Nin UTSW 12 70,101,308 (GRCm39) missense probably benign 0.22
R6562:Nin UTSW 12 70,102,728 (GRCm39) missense probably damaging 1.00
R6578:Nin UTSW 12 70,107,968 (GRCm39) missense probably damaging 0.99
R6613:Nin UTSW 12 70,077,728 (GRCm39) missense probably damaging 1.00
R7112:Nin UTSW 12 70,149,573 (GRCm39) missense
R7170:Nin UTSW 12 70,091,013 (GRCm39) missense
R7324:Nin UTSW 12 70,090,508 (GRCm39) missense
R7338:Nin UTSW 12 70,090,838 (GRCm39) missense
R7372:Nin UTSW 12 70,102,803 (GRCm39) missense
R7431:Nin UTSW 12 70,124,997 (GRCm39) missense
R7577:Nin UTSW 12 70,109,480 (GRCm39) missense
R7655:Nin UTSW 12 70,089,542 (GRCm39) missense
R7656:Nin UTSW 12 70,089,542 (GRCm39) missense
R7683:Nin UTSW 12 70,124,956 (GRCm39) missense
R7769:Nin UTSW 12 70,090,004 (GRCm39) missense
R7981:Nin UTSW 12 70,089,591 (GRCm39) missense
R8138:Nin UTSW 12 70,089,672 (GRCm39) missense
R8141:Nin UTSW 12 70,076,795 (GRCm39) missense
R8754:Nin UTSW 12 70,077,787 (GRCm39) intron probably benign
R8790:Nin UTSW 12 70,067,793 (GRCm39) missense
R8899:Nin UTSW 12 70,077,710 (GRCm39) missense probably damaging 1.00
R8974:Nin UTSW 12 70,124,932 (GRCm39) missense
R9085:Nin UTSW 12 70,076,786 (GRCm39) nonsense probably null
R9143:Nin UTSW 12 70,137,349 (GRCm39) missense
R9380:Nin UTSW 12 70,074,805 (GRCm39) missense
R9496:Nin UTSW 12 70,102,762 (GRCm39) missense
R9638:Nin UTSW 12 70,067,618 (GRCm39) missense
R9709:Nin UTSW 12 70,149,468 (GRCm39) missense
R9745:Nin UTSW 12 70,089,899 (GRCm39) missense
R9792:Nin UTSW 12 70,094,009 (GRCm39) missense
Z1176:Nin UTSW 12 70,095,938 (GRCm39) critical splice acceptor site probably null
Z1177:Nin UTSW 12 70,101,200 (GRCm39) missense
Z1177:Nin UTSW 12 70,090,869 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- AAGATTGCTCCAAGCCTCTCAC -3'
(R):5'- TTGGGACAGAAGCACCTGTTG -3'

Sequencing Primer
(F):5'- TCTCCTCAGTCCAGGCAG -3'
(R):5'- ACCTGTTGCACCCATACCC -3'
Posted On 2017-06-26