Mutagenetix > Incidental Mutations

Incidental Mutation 'R5992:Nin'

480904

Institutional Source

Beutler Lab

Gene Symbol

Nin

Ensembl Gene

ENSMUSG00000021068

Gene Name

ninein

Synonyms

3110068G20Rik

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5992 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

70011435-70113717 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 70045524 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 670 (S670R)

Ref Sequence

ENSEMBL: ENSMUSP00000152530 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021468] [ENSMUST00000085314] [ENSMUST00000095666] [ENSMUST00000169074] [ENSMUST00000220689] [ENSMUST00000222237] [ENSMUST00000222835] [ENSMUST00000223257]

AlphaFold

Q61043

Predicted Effect

probably benign
Transcript: ENSMUST00000021468
AA Change: S670R

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000021468
Gene: ENSMUSG00000021068
AA Change: S670R

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	7.83e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	7.83e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1980	2013	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000085314
AA Change: S670R

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000082422
Gene: ENSMUSG00000021068
AA Change: S670R

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	4.15e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	4.15e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1971	2045	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000095666
AA Change: S670R

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000093327
Gene: ENSMUSG00000021068
AA Change: S670R

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	7.83e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	7.83e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1980	2013	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169074
AA Change: S670R

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000129648
Gene: ENSMUSG00000021068
AA Change: S670R

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	7.83e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	7.83e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1980	2013	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000220689
AA Change: S670R

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221486

Predicted Effect

probably benign
Transcript: ENSMUST00000222237
AA Change: S670R

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)

Predicted Effect

probably benign
Transcript: ENSMUST00000222835
AA Change: S670R

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

Predicted Effect

probably benign
Transcript: ENSMUST00000223257
AA Change: S670R

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223316

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 91.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the proteins important for centrosomal function. This protein is important for positioning and anchoring the microtubules minus-ends in epithelial cells. Localization of this protein to the centrosome requires three leucine zippers in the central coiled-coil domain. Multiple alternatively spliced transcript variants that encode different isoforms have been reported. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars2	T	A	17: 45,508,623	L188*	probably null	Het
Acod1	C	T	14: 103,055,035	R332C	probably damaging	Het
Adamts3	T	A	5: 89,691,335	K852M	probably damaging	Het
Adm	A	T	7: 110,627,696		probably benign	Het
Aff4	A	G	11: 53,373,010	S286G	probably damaging	Het
Ank2	A	G	3: 126,959,651		probably null	Het
Aqr	A	T	2: 114,143,049	Y427*	probably null	Het
Arid1b	C	A	17: 4,994,956		probably benign	Het
Arpp21	T	A	9: 112,143,485	R259*	probably null	Het
Cep290	C	T	10: 100,543,321	A55V	possibly damaging	Het
Chsy3	GT	G	18: 59,176,166	163	probably null	Het
Clcn2	T	C	16: 20,713,654	E68G	possibly damaging	Het
Corin	T	A	5: 72,316,389	H699L	probably benign	Het
Cyld	T	C	8: 88,733,053	Y446H	probably damaging	Het
Dcst1	T	A	3: 89,352,576	E613V	probably damaging	Het
Dlk1	T	C	12: 109,455,581	C74R	probably damaging	Het
Dnah12	A	C	14: 26,697,341	K128T	probably benign	Het
Dspp	T	A	5: 104,178,451	S893R	unknown	Het
Dtl	A	T	1: 191,568,572		probably null	Het
F2rl1	T	A	13: 95,514,270	S35C	probably benign	Het
Fcgbp	A	T	7: 28,120,534	Y2562F	probably benign	Het
Fgf10	A	T	13: 118,715,508	D42V	probably benign	Het
Gm10271	A	T	10: 116,972,592	F6L	probably damaging	Het
Gm21190	T	A	5: 15,524,851	E256D	probably damaging	Het
Gm5157	A	G	7: 21,185,421	S66P	probably damaging	Het
Gm884	A	T	11: 103,613,792	M2450K	possibly damaging	Het
Hal	T	G	10: 93,490,916	L138R	probably damaging	Het
Hsd17b3	T	C	13: 64,059,470		probably null	Het
Lrsam1	T	C	2: 32,955,222	T94A	probably benign	Het
Macc1	T	C	12: 119,447,585	V696A	probably damaging	Het
Magi2	G	A	5: 19,227,291	M1I	probably null	Het
March7	C	A	2: 60,245,220	N674K	probably benign	Het
Mfap1b	A	G	2: 121,470,295	V34A	probably benign	Het
Mob3b	G	A	4: 35,084,069	S40L	probably benign	Het
Ndufs2	A	T	1: 171,236,418	V386E	probably damaging	Het
Nfic	C	T	10: 81,420,747	A19T	probably damaging	Het
Nfs1	G	A	2: 156,134,453	R174W	probably damaging	Het
Nrxn1	T	C	17: 90,623,507	I754V	probably benign	Het
Nwd1	T	C	8: 72,653,573		probably null	Het
Olfr1231	T	A	2: 89,303,359	T78S	possibly damaging	Het
Olfr1238	T	A	2: 89,406,879	M67L	probably benign	Het
Olfr575	G	T	7: 102,955,009	N197K	probably benign	Het
Pcdhgb8	A	G	18: 37,763,449	E524G	probably damaging	Het
Phlpp1	A	T	1: 106,318,993	R638*	probably null	Het
Pkmyt1	G	C	17: 23,735,326	W360S	probably benign	Het
Plxnd1	C	A	6: 115,967,787		probably null	Het
Poldip3	A	T	15: 83,129,229	N322K	probably damaging	Het
Prmt3	A	T	7: 49,828,947	I419L	probably benign	Het
Prss36	A	T	7: 127,944,830	V123E	probably damaging	Het
Prss58	A	G	6: 40,897,769	I46T	probably damaging	Het
Rac1	T	C	5: 143,506,998		probably benign	Het
Rb1cc1	A	G	1: 6,233,996	Y36C	probably damaging	Het
Rif1	C	G	2: 52,095,844	L614V	probably damaging	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Rp1	A	T	1: 4,148,703	F951L	unknown	Het
Rps6ka5	G	T	12: 100,575,250	P417T	possibly damaging	Het
Ryr1	A	G	7: 29,067,637	W2967R	probably damaging	Het
Sacs	T	A	14: 61,205,543	S1679R	probably damaging	Het
Scn1a	A	C	2: 66,335,456	W153G	probably damaging	Het
Serpinb7	A	G	1: 107,445,996	Y114C	probably damaging	Het
Son	T	C	16: 91,658,904	M1513T	probably benign	Het
Spag8	C	T	4: 43,651,534	V447M	probably benign	Het
St3gal2	T	A	8: 110,969,553	Y257N	probably damaging	Het
Tars	A	T	15: 11,397,196	D40E	probably damaging	Het
Tlr3	T	C	8: 45,397,814	H158R	probably benign	Het
Tppp2	G	T	14: 51,918,935	V50L	probably benign	Het
Trrap	T	C	5: 144,810,184	S1503P	probably benign	Het
Ttll4	T	G	1: 74,685,391	S573R	probably damaging	Het
Vmn2r104	A	T	17: 20,029,485	N841K	probably damaging	Het
Vmn2r3	A	T	3: 64,259,647	C688S	probably damaging	Het
Vps16	T	C	2: 130,424,449		probably null	Het
Zfp608	G	A	18: 54,899,248	T540I	probably benign	Het
Zfp775	G	A	6: 48,619,816	R208Q	probably damaging	Het

Other mutations in Nin

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00472:Nin	APN	12	70030088	missense	probably damaging	0.98
IGL00677:Nin	APN	12	70026860	missense	probably damaging	1.00
IGL00823:Nin	APN	12	70014793	missense	probably benign	0.01
IGL01103:Nin	APN	12	70056758	missense	probably damaging	0.99
IGL01113:Nin	APN	12	70031779	missense	probably damaging	1.00
IGL01420:Nin	APN	12	70045414	missense	probably benign	0.08
IGL01556:Nin	APN	12	70043188	missense	probably benign	0.01
IGL01663:Nin	APN	12	70043665	missense	possibly damaging	0.72
IGL02002:Nin	APN	12	70062699	nonsense	probably null
IGL02030:Nin	APN	12	70045268	missense	probably damaging	1.00
IGL02202:Nin	APN	12	70055436	missense	probably damaging	1.00
IGL02207:Nin	APN	12	70056657	missense	probably damaging	0.99
IGL02257:Nin	APN	12	70102691	missense	possibly damaging	0.71
IGL02394:Nin	APN	12	70044031	missense	probably damaging	1.00
IGL02531:Nin	APN	12	70020932	missense	probably benign	0.02
IGL03028:Nin	APN	12	70035270	missense	probably benign	0.13
IGL03155:Nin	APN	12	70031770	missense	probably damaging	1.00
IGL03197:Nin	APN	12	70026810	missense	probably benign	0.03
IGL02835:Nin	UTSW	12	70056738	missense	probably damaging	1.00
R0131:Nin	UTSW	12	70051141	missense	probably damaging	1.00
R0131:Nin	UTSW	12	70051141	missense	probably damaging	1.00
R0132:Nin	UTSW	12	70051141	missense	probably damaging	1.00
R0211:Nin	UTSW	12	70014875	missense	probably damaging	1.00
R0211:Nin	UTSW	12	70014875	missense	probably damaging	1.00
R0734:Nin	UTSW	12	70030113	missense	probably benign	0.01
R0947:Nin	UTSW	12	70061186	missense	probably damaging	1.00
R1085:Nin	UTSW	12	70020962	missense	possibly damaging	0.91
R1367:Nin	UTSW	12	70043929	missense	probably damaging	0.99
R1452:Nin	UTSW	12	70017650	nonsense	probably null
R1477:Nin	UTSW	12	70044184	missense	possibly damaging	0.87
R1518:Nin	UTSW	12	70014773	missense	probably benign	0.27
R1566:Nin	UTSW	12	70054479	missense	probably damaging	0.99
R1572:Nin	UTSW	12	70038750	missense	probably damaging	1.00
R1583:Nin	UTSW	12	70031738	missense	probably benign
R1584:Nin	UTSW	12	70042669	missense	probably benign	0.03
R1699:Nin	UTSW	12	70030938	missense	probably benign	0.40
R1699:Nin	UTSW	12	70045563	missense	possibly damaging	0.87
R1765:Nin	UTSW	12	70042891	missense	probably damaging	1.00
R1794:Nin	UTSW	12	70043795	nonsense	probably null
R1952:Nin	UTSW	12	70030926	missense	probably damaging	1.00
R2004:Nin	UTSW	12	70025477	missense	probably benign	0.01
R2025:Nin	UTSW	12	70030008	missense	probably damaging	1.00
R2060:Nin	UTSW	12	70042418	missense	possibly damaging	0.64
R2213:Nin	UTSW	12	70045354	missense	probably damaging	1.00
R2224:Nin	UTSW	12	70061230	missense	probably damaging	1.00
R2247:Nin	UTSW	12	70054545	missense	probably damaging	1.00
R2972:Nin	UTSW	12	70062713	missense	probably damaging	1.00
R3776:Nin	UTSW	12	70038682	missense	possibly damaging	0.71
R3881:Nin	UTSW	12	70042541	missense	probably benign	0.00
R3930:Nin	UTSW	12	70078242	missense	probably damaging	1.00
R3959:Nin	UTSW	12	70050752	missense	probably damaging	1.00
R4229:Nin	UTSW	12	70051210	missense	probably damaging	0.99
R4359:Nin	UTSW	12	70014938	missense	probably benign	0.00
R4423:Nin	UTSW	12	70042978	missense	probably damaging	1.00
R4461:Nin	UTSW	12	70042585	missense	probably benign	0.37
R4639:Nin	UTSW	12	70038601	missense	probably damaging	0.97
R4791:Nin	UTSW	12	70043807	missense	possibly damaging	0.94
R4839:Nin	UTSW	12	70090551	missense	possibly damaging	0.46
R4912:Nin	UTSW	12	70044063	missense	probably damaging	1.00
R5712:Nin	UTSW	12	70042769	missense	probably damaging	1.00
R5726:Nin	UTSW	12	70078179	missense	probably damaging	1.00
R5804:Nin	UTSW	12	70045601	missense	possibly damaging	0.58
R5874:Nin	UTSW	12	70030918	missense	possibly damaging	0.94
R6077:Nin	UTSW	12	70019232	missense	probably damaging	1.00
R6184:Nin	UTSW	12	70043737	missense	probably damaging	1.00
R6307:Nin	UTSW	12	70014857	missense	possibly damaging	0.91
R6315:Nin	UTSW	12	70045615	missense	probably damaging	1.00
R6326:Nin	UTSW	12	70045181	missense	possibly damaging	0.95
R6492:Nin	UTSW	12	70054534	missense	probably benign	0.22
R6562:Nin	UTSW	12	70055954	missense	probably damaging	1.00
R6578:Nin	UTSW	12	70061194	missense	probably damaging	0.99
R6613:Nin	UTSW	12	70030954	missense	probably damaging	1.00
R7112:Nin	UTSW	12	70102799	missense
R7170:Nin	UTSW	12	70044239	missense
R7324:Nin	UTSW	12	70043734	missense
R7338:Nin	UTSW	12	70044064	missense
R7372:Nin	UTSW	12	70056029	missense
R7431:Nin	UTSW	12	70078223	missense
R7577:Nin	UTSW	12	70062706	missense
R7655:Nin	UTSW	12	70042768	missense
R7656:Nin	UTSW	12	70042768	missense
R7683:Nin	UTSW	12	70078182	missense
R7769:Nin	UTSW	12	70043230	missense
R7981:Nin	UTSW	12	70042817	missense
R8138:Nin	UTSW	12	70042898	missense
R8141:Nin	UTSW	12	70030021	missense
R8754:Nin	UTSW	12	70031013	intron	probably benign
R8790:Nin	UTSW	12	70021019	missense
R8899:Nin	UTSW	12	70030936	missense	probably damaging	1.00
R8974:Nin	UTSW	12	70078158	missense
R9085:Nin	UTSW	12	70030012	nonsense	probably null
R9143:Nin	UTSW	12	70090575	missense
R9380:Nin	UTSW	12	70028031	missense
Z1176:Nin	UTSW	12	70049164	critical splice acceptor site	probably null
Z1177:Nin	UTSW	12	70044095	missense
Z1177:Nin	UTSW	12	70054426	missense

Predicted Primers

PCR Primer
(F):5'- AAGATTGCTCCAAGCCTCTCAC -3'
(R):5'- TTGGGACAGAAGCACCTGTTG -3'

Sequencing Primer
(F):5'- TCTCCTCAGTCCAGGCAG -3'
(R):5'- ACCTGTTGCACCCATACCC -3'

Posted On

2017-06-26