Incidental Mutation 'R5992:Dlk1'
ID480906
Institutional Source Beutler Lab
Gene Symbol Dlk1
Ensembl Gene ENSMUSG00000040856
Gene Namedelta like non-canonical Notch ligand 1
SynonymspG2, SCP1, ZOG, FA1, Peg9, pref-1, DlkI
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.752) question?
Stock #R5992 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location109452823-109463336 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109455581 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 74 (C74R)
Ref Sequence ENSEMBL: ENSMUSP00000105472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056110] [ENSMUST00000109841] [ENSMUST00000109842] [ENSMUST00000109843] [ENSMUST00000109844] [ENSMUST00000109846] [ENSMUST00000124293] [ENSMUST00000173539]
Predicted Effect probably damaging
Transcript: ENSMUST00000056110
AA Change: C74R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063104
Gene: ENSMUSG00000040856
AA Change: C74R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
EGF 213 247 4.06e-6 SMART
transmembrane domain 307 329 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109841
AA Change: C74R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105467
Gene: ENSMUSG00000040856
AA Change: C74R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
transmembrane domain 214 236 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109842
AA Change: C74R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105468
Gene: ENSMUSG00000040856
AA Change: C74R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
transmembrane domain 234 256 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109843
AA Change: C74R

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105469
Gene: ENSMUSG00000040856
AA Change: C74R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
transmembrane domain 212 234 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109844
AA Change: C74R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105470
Gene: ENSMUSG00000040856
AA Change: C74R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
EGF 213 247 4.06e-6 SMART
transmembrane domain 307 329 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109846
AA Change: C74R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105472
Gene: ENSMUSG00000040856
AA Change: C74R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
transmembrane domain 256 278 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000124293
AA Change: C73R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133530
Gene: ENSMUSG00000040856
AA Change: C73R

DomainStartEndE-ValueType
EGF 24 54 1.43e-1 SMART
EGF 55 85 1.26e-2 SMART
EGF_CA 87 124 1.77e-6 SMART
EGF 129 167 8.71e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173539
AA Change: C74R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133430
Gene: ENSMUSG00000040856
AA Change: C74R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
transmembrane domain 232 254 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173812
SMART Domains Protein: ENSMUSP00000134308
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
SCOP:d1eqga2 2 15 4e-3 SMART
transmembrane domain 44 66 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174539
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that contains multiple epidermal growth factor repeats that functions as a regulator of cell growth. The encoded protein is involved in the differentiation of several cell types including adipocytes. This gene is located in a region of chromosome 14 frequently showing unparental disomy, and is imprinted and expressed from the paternal allele. A single nucleotide variant in this gene is associated with child and adolescent obesity and shows polar overdominance, where heterozygotes carrying an active paternal allele express the phenotype, while mutant homozygotes are normal. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygote null mice have reduced fetal growth and 50% lethality 2 days after birth. Survivors are small but have enlarged fat pad masses. Homozygotes for another null allele have abnormal B cell development. Paternally-inherited null alleles phenocopy homozygotes due to maternal imprinting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,508,623 L188* probably null Het
Acod1 C T 14: 103,055,035 R332C probably damaging Het
Adamts3 T A 5: 89,691,335 K852M probably damaging Het
Adm A T 7: 110,627,696 probably benign Het
Aff4 A G 11: 53,373,010 S286G probably damaging Het
Ank2 A G 3: 126,959,651 probably null Het
Aqr A T 2: 114,143,049 Y427* probably null Het
Arid1b C A 17: 4,994,956 probably benign Het
Arpp21 T A 9: 112,143,485 R259* probably null Het
Cep290 C T 10: 100,543,321 A55V possibly damaging Het
Chsy3 GT G 18: 59,176,166 probably null Het
Clcn2 T C 16: 20,713,654 E68G possibly damaging Het
Corin T A 5: 72,316,389 H699L probably benign Het
Cyld T C 8: 88,733,053 Y446H probably damaging Het
Dcst1 T A 3: 89,352,576 E613V probably damaging Het
Dnah12 A C 14: 26,697,341 K128T probably benign Het
Dspp T A 5: 104,178,451 S893R unknown Het
Dtl A T 1: 191,568,572 probably null Het
F2rl1 T A 13: 95,514,270 S35C probably benign Het
Fcgbp A T 7: 28,120,534 Y2562F probably benign Het
Fgf10 A T 13: 118,715,508 D42V probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm21190 T A 5: 15,524,851 E256D probably damaging Het
Gm5157 A G 7: 21,185,421 S66P probably damaging Het
Gm884 A T 11: 103,613,792 M2450K possibly damaging Het
Hal T G 10: 93,490,916 L138R probably damaging Het
Hsd17b3 T C 13: 64,059,470 probably null Het
Lrsam1 T C 2: 32,955,222 T94A probably benign Het
Macc1 T C 12: 119,447,585 V696A probably damaging Het
Magi2 G A 5: 19,227,291 M1I probably null Het
March7 C A 2: 60,245,220 N674K probably benign Het
Mfap1b A G 2: 121,470,295 V34A probably benign Het
Mob3b G A 4: 35,084,069 S40L probably benign Het
Ndufs2 A T 1: 171,236,418 V386E probably damaging Het
Nfic C T 10: 81,420,747 A19T probably damaging Het
Nfs1 G A 2: 156,134,453 R174W probably damaging Het
Nin G T 12: 70,045,524 S670R possibly damaging Het
Nrxn1 T C 17: 90,623,507 I754V probably benign Het
Nwd1 T C 8: 72,653,573 probably null Het
Olfr1231 T A 2: 89,303,359 T78S possibly damaging Het
Olfr1238 T A 2: 89,406,879 M67L probably benign Het
Olfr575 G T 7: 102,955,009 N197K probably benign Het
Pcdhgb8 A G 18: 37,763,449 E524G probably damaging Het
Phlpp1 A T 1: 106,318,993 R638* probably null Het
Pkmyt1 G C 17: 23,735,326 W360S probably benign Het
Plxnd1 C A 6: 115,967,787 probably null Het
Poldip3 A T 15: 83,129,229 N322K probably damaging Het
Prmt3 A T 7: 49,828,947 I419L probably benign Het
Prss36 A T 7: 127,944,830 V123E probably damaging Het
Prss58 A G 6: 40,897,769 I46T probably damaging Het
Rac1 T C 5: 143,506,998 probably benign Het
Rb1cc1 A G 1: 6,233,996 Y36C probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rp1 A T 1: 4,148,703 F951L unknown Het
Rps6ka5 G T 12: 100,575,250 P417T possibly damaging Het
Ryr1 A G 7: 29,067,637 W2967R probably damaging Het
Sacs T A 14: 61,205,543 S1679R probably damaging Het
Scn1a A C 2: 66,335,456 W153G probably damaging Het
Serpinb7 A G 1: 107,445,996 Y114C probably damaging Het
Son T C 16: 91,658,904 M1513T probably benign Het
Spag8 C T 4: 43,651,534 V447M probably benign Het
St3gal2 T A 8: 110,969,553 Y257N probably damaging Het
Tars A T 15: 11,397,196 D40E probably damaging Het
Tlr3 T C 8: 45,397,814 H158R probably benign Het
Tppp2 G T 14: 51,918,935 V50L probably benign Het
Trrap T C 5: 144,810,184 S1503P probably benign Het
Ttll4 T G 1: 74,685,391 S573R probably damaging Het
Vmn2r104 A T 17: 20,029,485 N841K probably damaging Het
Vmn2r3 A T 3: 64,259,647 C688S probably damaging Het
Vps16 T C 2: 130,424,449 probably null Het
Zfp608 G A 18: 54,899,248 T540I probably benign Het
Zfp775 G A 6: 48,619,816 R208Q probably damaging Het
Other mutations in Dlk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0041:Dlk1 UTSW 12 109455513 missense probably damaging 1.00
R0379:Dlk1 UTSW 12 109455059 unclassified probably benign
R1250:Dlk1 UTSW 12 109459818 missense probably damaging 1.00
R1363:Dlk1 UTSW 12 109455504 missense probably damaging 1.00
R1757:Dlk1 UTSW 12 109459687 missense probably damaging 1.00
R1763:Dlk1 UTSW 12 109458119 missense probably damaging 1.00
R1772:Dlk1 UTSW 12 109459759 missense probably damaging 1.00
R2189:Dlk1 UTSW 12 109455049 critical splice donor site probably null
R2334:Dlk1 UTSW 12 109453688 missense probably damaging 0.96
R3751:Dlk1 UTSW 12 109460313 missense probably benign 0.15
R5256:Dlk1 UTSW 12 109459771 missense probably damaging 1.00
R5268:Dlk1 UTSW 12 109459838 missense probably benign 0.34
R5356:Dlk1 UTSW 12 109455521 missense probably damaging 0.99
R5669:Dlk1 UTSW 12 109460038 missense probably benign 0.04
R5748:Dlk1 UTSW 12 109459972 missense probably benign 0.00
R6076:Dlk1 UTSW 12 109459969 missense probably damaging 0.98
R6539:Dlk1 UTSW 12 109460319 missense probably benign 0.01
R6638:Dlk1 UTSW 12 109460278 missense probably damaging 1.00
R7480:Dlk1 UTSW 12 109455614 missense probably damaging 1.00
R7553:Dlk1 UTSW 12 109454963 missense unknown
R7602:Dlk1 UTSW 12 109455625 critical splice donor site probably null
X0020:Dlk1 UTSW 12 109459912 missense probably damaging 1.00
X0053:Dlk1 UTSW 12 109460137 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCCTGGGACTCAACAAAG -3'
(R):5'- AATACATTTGAGGCCCAGCAG -3'

Sequencing Primer
(F):5'- CCAAATGTTCTCCATACAGCAG -3'
(R):5'- GCCCAGCAGGAAGAGCTTATAC -3'
Posted On2017-06-26