Incidental Mutation 'R5992:Fgf10'
ID480909
Institutional Source Beutler Lab
Gene Symbol Fgf10
Ensembl Gene ENSMUSG00000021732
Gene Namefibroblast growth factor 10
SynonymsGsfaey17, AEY17, FGF-10
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5992 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location118669791-118792115 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 118715508 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 42 (D42V)
Ref Sequence ENSEMBL: ENSMUSP00000022246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022246]
Predicted Effect probably benign
Transcript: ENSMUST00000022246
AA Change: D42V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022246
Gene: ENSMUSG00000021732
AA Change: D42V

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
FGF 77 206 9.61e-70 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146674
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein exhibits mitogenic activity for keratinizing epidermal cells, but essentially no activity for fibroblasts, which is similar to the biological activity of FGF7. Studies of the mouse homolog of suggested that this gene is required for embryonic epidermal morphogenesis including brain development, lung morphogenesis, and initiation of lim bud formation. This gene is also implicated to be a primary factor in the process of wound healing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants die at birth with multiple abnormalities including absence of lungs, severely truncated limbs, open eyelids, incomplete external genitalia, arrested pancreatic development, lack of mammary glands and impaired epidermal development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,508,623 L188* probably null Het
Acod1 C T 14: 103,055,035 R332C probably damaging Het
Adamts3 T A 5: 89,691,335 K852M probably damaging Het
Adm A T 7: 110,627,696 probably benign Het
Aff4 A G 11: 53,373,010 S286G probably damaging Het
Ank2 A G 3: 126,959,651 probably null Het
Aqr A T 2: 114,143,049 Y427* probably null Het
Arid1b C A 17: 4,994,956 probably benign Het
Arpp21 T A 9: 112,143,485 R259* probably null Het
Cep290 C T 10: 100,543,321 A55V possibly damaging Het
Chsy3 GT G 18: 59,176,166 probably null Het
Clcn2 T C 16: 20,713,654 E68G possibly damaging Het
Corin T A 5: 72,316,389 H699L probably benign Het
Cyld T C 8: 88,733,053 Y446H probably damaging Het
Dcst1 T A 3: 89,352,576 E613V probably damaging Het
Dlk1 T C 12: 109,455,581 C74R probably damaging Het
Dnah12 A C 14: 26,697,341 K128T probably benign Het
Dspp T A 5: 104,178,451 S893R unknown Het
Dtl A T 1: 191,568,572 probably null Het
F2rl1 T A 13: 95,514,270 S35C probably benign Het
Fcgbp A T 7: 28,120,534 Y2562F probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm21190 T A 5: 15,524,851 E256D probably damaging Het
Gm5157 A G 7: 21,185,421 S66P probably damaging Het
Gm884 A T 11: 103,613,792 M2450K possibly damaging Het
Hal T G 10: 93,490,916 L138R probably damaging Het
Hsd17b3 T C 13: 64,059,470 probably null Het
Lrsam1 T C 2: 32,955,222 T94A probably benign Het
Macc1 T C 12: 119,447,585 V696A probably damaging Het
Magi2 G A 5: 19,227,291 M1I probably null Het
March7 C A 2: 60,245,220 N674K probably benign Het
Mfap1b A G 2: 121,470,295 V34A probably benign Het
Mob3b G A 4: 35,084,069 S40L probably benign Het
Ndufs2 A T 1: 171,236,418 V386E probably damaging Het
Nfic C T 10: 81,420,747 A19T probably damaging Het
Nfs1 G A 2: 156,134,453 R174W probably damaging Het
Nin G T 12: 70,045,524 S670R possibly damaging Het
Nrxn1 T C 17: 90,623,507 I754V probably benign Het
Nwd1 T C 8: 72,653,573 probably null Het
Olfr1231 T A 2: 89,303,359 T78S possibly damaging Het
Olfr1238 T A 2: 89,406,879 M67L probably benign Het
Olfr575 G T 7: 102,955,009 N197K probably benign Het
Pcdhgb8 A G 18: 37,763,449 E524G probably damaging Het
Phlpp1 A T 1: 106,318,993 R638* probably null Het
Pkmyt1 G C 17: 23,735,326 W360S probably benign Het
Plxnd1 C A 6: 115,967,787 probably null Het
Poldip3 A T 15: 83,129,229 N322K probably damaging Het
Prmt3 A T 7: 49,828,947 I419L probably benign Het
Prss36 A T 7: 127,944,830 V123E probably damaging Het
Prss58 A G 6: 40,897,769 I46T probably damaging Het
Rac1 T C 5: 143,506,998 probably benign Het
Rb1cc1 A G 1: 6,233,996 Y36C probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rp1 A T 1: 4,148,703 F951L unknown Het
Rps6ka5 G T 12: 100,575,250 P417T possibly damaging Het
Ryr1 A G 7: 29,067,637 W2967R probably damaging Het
Sacs T A 14: 61,205,543 S1679R probably damaging Het
Scn1a A C 2: 66,335,456 W153G probably damaging Het
Serpinb7 A G 1: 107,445,996 Y114C probably damaging Het
Son T C 16: 91,658,904 M1513T probably benign Het
Spag8 C T 4: 43,651,534 V447M probably benign Het
St3gal2 T A 8: 110,969,553 Y257N probably damaging Het
Tars A T 15: 11,397,196 D40E probably damaging Het
Tlr3 T C 8: 45,397,814 H158R probably benign Het
Tppp2 G T 14: 51,918,935 V50L probably benign Het
Trrap T C 5: 144,810,184 S1503P probably benign Het
Ttll4 T G 1: 74,685,391 S573R probably damaging Het
Vmn2r104 A T 17: 20,029,485 N841K probably damaging Het
Vmn2r3 A T 3: 64,259,647 C688S probably damaging Het
Vps16 T C 2: 130,424,449 probably null Het
Zfp608 G A 18: 54,899,248 T540I probably benign Het
Zfp775 G A 6: 48,619,816 R208Q probably damaging Het
Other mutations in Fgf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03400:Fgf10 APN 13 118781615 splice site probably null
R0487:Fgf10 UTSW 13 118781611 critical splice donor site probably null
R0789:Fgf10 UTSW 13 118789205 missense probably benign
R1876:Fgf10 UTSW 13 118789159 missense probably damaging 1.00
R1939:Fgf10 UTSW 13 118789152 missense probably damaging 1.00
R2032:Fgf10 UTSW 13 118715595 missense probably damaging 1.00
R3768:Fgf10 UTSW 13 118781547 missense probably damaging 1.00
R3769:Fgf10 UTSW 13 118781547 missense probably damaging 1.00
R4756:Fgf10 UTSW 13 118781509 missense probably benign 0.03
R6289:Fgf10 UTSW 13 118715492 missense probably benign 0.01
R6301:Fgf10 UTSW 13 118715511 missense probably benign 0.02
R6755:Fgf10 UTSW 13 118789285 missense probably damaging 1.00
R7174:Fgf10 UTSW 13 118715406 missense probably benign 0.39
R7189:Fgf10 UTSW 13 118789123 missense probably benign 0.02
X0024:Fgf10 UTSW 13 118715544 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAGTATGTTCCTTCTGATGAGAC -3'
(R):5'- GAGAGGAGCACGCATTTGTTAC -3'

Sequencing Primer
(F):5'- TGAGACAATTTCCAGTGCCG -3'
(R):5'- AGGAGCACGCATTTGTTACTTACTG -3'
Posted On2017-06-26