Incidental Mutation 'R5992:Clcn2'
ID 480916
Institutional Source Beutler Lab
Gene Symbol Clcn2
Ensembl Gene ENSMUSG00000022843
Gene Name chloride channel, voltage-sensitive 2
Synonyms nmf240, Clc2, ClC-2
Accession Numbers
Essential gene? Possibly essential (E-score: 0.641) question?
Stock # R5992 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 20521714-20536496 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 20532404 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 68 (E68G)
Ref Sequence ENSEMBL: ENSMUSP00000112759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007207] [ENSMUST00000021405] [ENSMUST00000120099] [ENSMUST00000131522] [ENSMUST00000161038] [ENSMUST00000232309] [ENSMUST00000231656] [ENSMUST00000231392]
AlphaFold Q9R0A1
Predicted Effect probably benign
Transcript: ENSMUST00000007207
AA Change: E68G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000007207
Gene: ENSMUSG00000022843
AA Change: E68G

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 102 111 N/A INTRINSIC
Pfam:Voltage_CLC 151 555 1.2e-94 PFAM
Blast:CBS 595 644 3e-12 BLAST
low complexity region 666 680 N/A INTRINSIC
CBS 803 850 3.69e0 SMART
low complexity region 869 881 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000021405
SMART Domains Protein: ENSMUSP00000021405
Gene: ENSMUSG00000021018

DomainStartEndE-ValueType
RPOL8c 2 147 5.28e-93 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000120099
AA Change: E68G

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112759
Gene: ENSMUSG00000022843
AA Change: E68G

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 102 111 N/A INTRINSIC
Pfam:Voltage_CLC 151 538 5.6e-77 PFAM
Blast:CBS 578 627 4e-12 BLAST
low complexity region 649 663 N/A INTRINSIC
CBS 786 833 3.69e0 SMART
low complexity region 852 864 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123417
Predicted Effect probably benign
Transcript: ENSMUST00000131522
AA Change: E68G

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000122921
Gene: ENSMUSG00000022843
AA Change: E68G

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 102 111 N/A INTRINSIC
Pfam:Voltage_CLC 151 473 4.2e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153075
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148131
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144400
Predicted Effect probably benign
Transcript: ENSMUST00000161038
Predicted Effect probably benign
Transcript: ENSMUST00000232309
AA Change: E68G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000231656
Predicted Effect probably benign
Transcript: ENSMUST00000231392
Predicted Effect probably benign
Transcript: ENSMUST00000231381
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated chloride channel. The encoded protein is a transmembrane protein that maintains chloride ion homeostasis in various cells. Defects in this gene may be a cause of certain epilepsies. Four transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal brain morphology, male infertility, and abnormal eye morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,819,549 (GRCm39) L188* probably null Het
Acod1 C T 14: 103,292,471 (GRCm39) R332C probably damaging Het
Adamts3 T A 5: 89,839,194 (GRCm39) K852M probably damaging Het
Adm A T 7: 110,226,903 (GRCm39) probably benign Het
Aff4 A G 11: 53,263,837 (GRCm39) S286G probably damaging Het
Ank2 A G 3: 126,753,300 (GRCm39) probably null Het
Aqr A T 2: 113,973,530 (GRCm39) Y427* probably null Het
Arid1b C A 17: 5,045,231 (GRCm39) probably benign Het
Arpp21 T A 9: 111,972,553 (GRCm39) R259* probably null Het
Cep290 C T 10: 100,379,183 (GRCm39) A55V possibly damaging Het
Chsy3 GT G 18: 59,309,238 (GRCm39) 163 probably null Het
Corin T A 5: 72,473,732 (GRCm39) H699L probably benign Het
Cyld T C 8: 89,459,681 (GRCm39) Y446H probably damaging Het
Dcst1 T A 3: 89,259,883 (GRCm39) E613V probably damaging Het
Dlk1 T C 12: 109,421,507 (GRCm39) C74R probably damaging Het
Dnah12 A C 14: 26,418,496 (GRCm39) K128T probably benign Het
Dspp T A 5: 104,326,317 (GRCm39) S893R unknown Het
Dtl A T 1: 191,300,684 (GRCm39) probably null Het
F2rl1 T A 13: 95,650,778 (GRCm39) S35C probably benign Het
Fcgbp A T 7: 27,819,959 (GRCm39) Y2562F probably benign Het
Fgf10 A T 13: 118,852,044 (GRCm39) D42V probably benign Het
Gm10271 A T 10: 116,808,497 (GRCm39) F6L probably damaging Het
Gm21190 T A 5: 15,729,849 (GRCm39) E256D probably damaging Het
Gm5157 A G 7: 20,919,346 (GRCm39) S66P probably damaging Het
Hal T G 10: 93,326,778 (GRCm39) L138R probably damaging Het
Hsd17b3 T C 13: 64,207,284 (GRCm39) probably null Het
Lrrc37 A T 11: 103,504,618 (GRCm39) M2450K possibly damaging Het
Lrsam1 T C 2: 32,845,234 (GRCm39) T94A probably benign Het
Macc1 T C 12: 119,411,320 (GRCm39) V696A probably damaging Het
Magi2 G A 5: 19,432,289 (GRCm39) M1I probably null Het
Marchf7 C A 2: 60,075,564 (GRCm39) N674K probably benign Het
Mfap1b A G 2: 121,300,776 (GRCm39) V34A probably benign Het
Mob3b G A 4: 35,084,069 (GRCm39) S40L probably benign Het
Ndufs2 A T 1: 171,063,987 (GRCm39) V386E probably damaging Het
Nfic C T 10: 81,256,581 (GRCm39) A19T probably damaging Het
Nfs1 G A 2: 155,976,373 (GRCm39) R174W probably damaging Het
Nin G T 12: 70,092,298 (GRCm39) S670R possibly damaging Het
Nrxn1 T C 17: 90,930,935 (GRCm39) I754V probably benign Het
Nwd1 T C 8: 73,380,201 (GRCm39) probably null Het
Or4a39 T A 2: 89,237,223 (GRCm39) M67L probably benign Het
Or4c1 T A 2: 89,133,703 (GRCm39) T78S possibly damaging Het
Or51a6 G T 7: 102,604,216 (GRCm39) N197K probably benign Het
Pcdhgb8 A G 18: 37,896,502 (GRCm39) E524G probably damaging Het
Phlpp1 A T 1: 106,246,723 (GRCm39) R638* probably null Het
Pkmyt1 G C 17: 23,954,300 (GRCm39) W360S probably benign Het
Plxnd1 C A 6: 115,944,748 (GRCm39) probably null Het
Poldip3 A T 15: 83,013,430 (GRCm39) N322K probably damaging Het
Prmt3 A T 7: 49,478,695 (GRCm39) I419L probably benign Het
Prss36 A T 7: 127,544,002 (GRCm39) V123E probably damaging Het
Prss58 A G 6: 40,874,703 (GRCm39) I46T probably damaging Het
Rac1 T C 5: 143,492,753 (GRCm39) probably benign Het
Rb1cc1 A G 1: 6,304,220 (GRCm39) Y36C probably damaging Het
Rif1 C G 2: 51,985,856 (GRCm39) L614V probably damaging Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Rp1 A T 1: 4,218,926 (GRCm39) F951L unknown Het
Rps6ka5 G T 12: 100,541,509 (GRCm39) P417T possibly damaging Het
Ryr1 A G 7: 28,767,062 (GRCm39) W2967R probably damaging Het
Sacs T A 14: 61,442,992 (GRCm39) S1679R probably damaging Het
Scn1a A C 2: 66,165,800 (GRCm39) W153G probably damaging Het
Serpinb7 A G 1: 107,373,726 (GRCm39) Y114C probably damaging Het
Son T C 16: 91,455,792 (GRCm39) M1513T probably benign Het
Spag8 C T 4: 43,651,534 (GRCm39) V447M probably benign Het
St3gal2 T A 8: 111,696,185 (GRCm39) Y257N probably damaging Het
Tars1 A T 15: 11,397,282 (GRCm39) D40E probably damaging Het
Tlr3 T C 8: 45,850,851 (GRCm39) H158R probably benign Het
Tppp2 G T 14: 52,156,392 (GRCm39) V50L probably benign Het
Trrap T C 5: 144,746,994 (GRCm39) S1503P probably benign Het
Ttll4 T G 1: 74,724,550 (GRCm39) S573R probably damaging Het
Vmn2r104 A T 17: 20,249,747 (GRCm39) N841K probably damaging Het
Vmn2r3 A T 3: 64,167,068 (GRCm39) C688S probably damaging Het
Vps16 T C 2: 130,266,369 (GRCm39) probably null Het
Zfp608 G A 18: 55,032,320 (GRCm39) T540I probably benign Het
Zfp775 G A 6: 48,596,750 (GRCm39) R208Q probably damaging Het
Other mutations in Clcn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Clcn2 APN 16 20,522,391 (GRCm39) missense probably benign 0.08
IGL01657:Clcn2 APN 16 20,532,369 (GRCm39) missense probably damaging 1.00
IGL01797:Clcn2 APN 16 20,531,511 (GRCm39) missense probably damaging 1.00
IGL02557:Clcn2 APN 16 20,527,214 (GRCm39) missense probably damaging 1.00
IGL02624:Clcn2 APN 16 20,522,098 (GRCm39) missense probably damaging 0.98
IGL02819:Clcn2 APN 16 20,528,006 (GRCm39) nonsense probably null
IGL03329:Clcn2 APN 16 20,530,902 (GRCm39) missense probably damaging 1.00
Bemr14 UTSW 16 0 () unclassified
R0008:Clcn2 UTSW 16 20,529,140 (GRCm39) missense probably null 1.00
R0454:Clcn2 UTSW 16 20,529,178 (GRCm39) critical splice acceptor site probably null
R1101:Clcn2 UTSW 16 20,522,345 (GRCm39) missense probably damaging 1.00
R1466:Clcn2 UTSW 16 20,531,302 (GRCm39) splice site probably benign
R1824:Clcn2 UTSW 16 20,534,712 (GRCm39) missense probably benign 0.04
R4592:Clcn2 UTSW 16 20,527,892 (GRCm39) missense probably damaging 0.99
R5011:Clcn2 UTSW 16 20,525,965 (GRCm39) missense probably damaging 1.00
R5013:Clcn2 UTSW 16 20,525,965 (GRCm39) missense probably damaging 1.00
R5154:Clcn2 UTSW 16 20,522,053 (GRCm39) missense probably benign 0.01
R5374:Clcn2 UTSW 16 20,528,419 (GRCm39) missense possibly damaging 0.78
R5726:Clcn2 UTSW 16 20,529,285 (GRCm39) intron probably benign
R5787:Clcn2 UTSW 16 20,522,183 (GRCm39) missense probably damaging 1.00
R6045:Clcn2 UTSW 16 20,530,438 (GRCm39) critical splice donor site probably null
R6663:Clcn2 UTSW 16 20,521,995 (GRCm39) makesense probably null
R6765:Clcn2 UTSW 16 20,526,418 (GRCm39) splice site probably null
R6825:Clcn2 UTSW 16 20,528,408 (GRCm39) utr 3 prime probably benign
R7872:Clcn2 UTSW 16 20,527,210 (GRCm39) missense probably damaging 0.99
R8028:Clcn2 UTSW 16 20,527,512 (GRCm39) missense possibly damaging 0.66
R8198:Clcn2 UTSW 16 20,525,946 (GRCm39) missense probably damaging 0.99
R8805:Clcn2 UTSW 16 20,532,168 (GRCm39) missense probably damaging 1.00
R8924:Clcn2 UTSW 16 20,530,930 (GRCm39) missense probably damaging 1.00
R8992:Clcn2 UTSW 16 20,531,080 (GRCm39) missense probably damaging 1.00
R9074:Clcn2 UTSW 16 20,531,414 (GRCm39) missense possibly damaging 0.78
R9101:Clcn2 UTSW 16 20,525,979 (GRCm39) missense probably benign 0.00
R9456:Clcn2 UTSW 16 20,534,702 (GRCm39) small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CTTGTGGCAGCGTACAGAAC -3'
(R):5'- ACCCAGGAACTCTCTGTCTC -3'

Sequencing Primer
(F):5'- TGGCAGCGTACAGAACAAACTG -3'
(R):5'- GTCTCCCCACCTCAGATACTCAG -3'
Posted On 2017-06-26