Incidental Mutation 'R5992:Son'
ID 480917
Institutional Source Beutler Lab
Gene Symbol Son
Ensembl Gene ENSMUSG00000022961
Gene Name Son DNA binding protein
Synonyms 2900011L12Rik
Accession Numbers
Essential gene? Probably essential (E-score: 0.955) question?
Stock # R5992 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 91444712-91476080 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 91455792 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 1513 (M1513T)
Ref Sequence ENSEMBL: ENSMUSP00000109671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114036] [ENSMUST00000114037] [ENSMUST00000117633] [ENSMUST00000119368] [ENSMUST00000122302] [ENSMUST00000140312]
AlphaFold Q9QX47
Predicted Effect probably benign
Transcript: ENSMUST00000114036
AA Change: M1513T

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000109670
Gene: ENSMUSG00000022961
AA Change: M1513T

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.65e-7 PROSPERO
internal_repeat_2 214 362 6.55e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.65e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 6.55e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114037
AA Change: M1513T

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000109671
Gene: ENSMUSG00000022961
AA Change: M1513T

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.71e-7 PROSPERO
internal_repeat_2 214 362 7.05e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.71e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 7.05e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
G_patch 2321 2367 1.15e-17 SMART
Pfam:DND1_DSRM 2388 2442 5.7e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117633
AA Change: M1513T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000112453
Gene: ENSMUSG00000022961
AA Change: M1513T

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.59e-7 PROSPERO
internal_repeat_2 214 362 6.63e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.59e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 6.63e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
Pfam:RSRP 1909 2216 1e-12 PFAM
G_patch 2321 2367 1.15e-17 SMART
DSRM 2390 2458 5.37e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119368
AA Change: M1513T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113129
Gene: ENSMUSG00000022961
AA Change: M1513T

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 2.22e-7 PROSPERO
internal_repeat_2 214 362 8.67e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 2.22e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 8.67e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122302
SMART Domains Protein: ENSMUSP00000113615
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
low complexity region 90 101 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 159 165 N/A INTRINSIC
G_patch 331 377 1.15e-17 SMART
Pfam:DND1_DSRM 398 452 7.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140312
AA Change: M1513T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000122320
Gene: ENSMUSG00000022961
AA Change: M1513T

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 2.93e-7 PROSPERO
internal_repeat_2 214 362 1.1e-5 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 2.93e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 1.1e-5 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147891
SMART Domains Protein: ENSMUSP00000122544
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
Pfam:RSRP 61 358 2.9e-13 PFAM
low complexity region 466 477 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains multiple simple repeats. The encoded protein binds RNA and promotes pre-mRNA splicing, particularly of transcripts with poor splice sites. The protein also recognizes a specific DNA sequence found in the human hepatitis B virus (HBV) and represses HBV core promoter activity. There is a pseudogene for this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,819,549 (GRCm39) L188* probably null Het
Acod1 C T 14: 103,292,471 (GRCm39) R332C probably damaging Het
Adamts3 T A 5: 89,839,194 (GRCm39) K852M probably damaging Het
Adm A T 7: 110,226,903 (GRCm39) probably benign Het
Aff4 A G 11: 53,263,837 (GRCm39) S286G probably damaging Het
Ank2 A G 3: 126,753,300 (GRCm39) probably null Het
Aqr A T 2: 113,973,530 (GRCm39) Y427* probably null Het
Arid1b C A 17: 5,045,231 (GRCm39) probably benign Het
Arpp21 T A 9: 111,972,553 (GRCm39) R259* probably null Het
Cep290 C T 10: 100,379,183 (GRCm39) A55V possibly damaging Het
Chsy3 GT G 18: 59,309,238 (GRCm39) 163 probably null Het
Clcn2 T C 16: 20,532,404 (GRCm39) E68G possibly damaging Het
Corin T A 5: 72,473,732 (GRCm39) H699L probably benign Het
Cyld T C 8: 89,459,681 (GRCm39) Y446H probably damaging Het
Dcst1 T A 3: 89,259,883 (GRCm39) E613V probably damaging Het
Dlk1 T C 12: 109,421,507 (GRCm39) C74R probably damaging Het
Dnah12 A C 14: 26,418,496 (GRCm39) K128T probably benign Het
Dspp T A 5: 104,326,317 (GRCm39) S893R unknown Het
Dtl A T 1: 191,300,684 (GRCm39) probably null Het
F2rl1 T A 13: 95,650,778 (GRCm39) S35C probably benign Het
Fcgbp A T 7: 27,819,959 (GRCm39) Y2562F probably benign Het
Fgf10 A T 13: 118,852,044 (GRCm39) D42V probably benign Het
Gm10271 A T 10: 116,808,497 (GRCm39) F6L probably damaging Het
Gm21190 T A 5: 15,729,849 (GRCm39) E256D probably damaging Het
Gm5157 A G 7: 20,919,346 (GRCm39) S66P probably damaging Het
Hal T G 10: 93,326,778 (GRCm39) L138R probably damaging Het
Hsd17b3 T C 13: 64,207,284 (GRCm39) probably null Het
Lrrc37 A T 11: 103,504,618 (GRCm39) M2450K possibly damaging Het
Lrsam1 T C 2: 32,845,234 (GRCm39) T94A probably benign Het
Macc1 T C 12: 119,411,320 (GRCm39) V696A probably damaging Het
Magi2 G A 5: 19,432,289 (GRCm39) M1I probably null Het
Marchf7 C A 2: 60,075,564 (GRCm39) N674K probably benign Het
Mfap1b A G 2: 121,300,776 (GRCm39) V34A probably benign Het
Mob3b G A 4: 35,084,069 (GRCm39) S40L probably benign Het
Ndufs2 A T 1: 171,063,987 (GRCm39) V386E probably damaging Het
Nfic C T 10: 81,256,581 (GRCm39) A19T probably damaging Het
Nfs1 G A 2: 155,976,373 (GRCm39) R174W probably damaging Het
Nin G T 12: 70,092,298 (GRCm39) S670R possibly damaging Het
Nrxn1 T C 17: 90,930,935 (GRCm39) I754V probably benign Het
Nwd1 T C 8: 73,380,201 (GRCm39) probably null Het
Or4a39 T A 2: 89,237,223 (GRCm39) M67L probably benign Het
Or4c1 T A 2: 89,133,703 (GRCm39) T78S possibly damaging Het
Or51a6 G T 7: 102,604,216 (GRCm39) N197K probably benign Het
Pcdhgb8 A G 18: 37,896,502 (GRCm39) E524G probably damaging Het
Phlpp1 A T 1: 106,246,723 (GRCm39) R638* probably null Het
Pkmyt1 G C 17: 23,954,300 (GRCm39) W360S probably benign Het
Plxnd1 C A 6: 115,944,748 (GRCm39) probably null Het
Poldip3 A T 15: 83,013,430 (GRCm39) N322K probably damaging Het
Prmt3 A T 7: 49,478,695 (GRCm39) I419L probably benign Het
Prss36 A T 7: 127,544,002 (GRCm39) V123E probably damaging Het
Prss58 A G 6: 40,874,703 (GRCm39) I46T probably damaging Het
Rac1 T C 5: 143,492,753 (GRCm39) probably benign Het
Rb1cc1 A G 1: 6,304,220 (GRCm39) Y36C probably damaging Het
Rif1 C G 2: 51,985,856 (GRCm39) L614V probably damaging Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Rp1 A T 1: 4,218,926 (GRCm39) F951L unknown Het
Rps6ka5 G T 12: 100,541,509 (GRCm39) P417T possibly damaging Het
Ryr1 A G 7: 28,767,062 (GRCm39) W2967R probably damaging Het
Sacs T A 14: 61,442,992 (GRCm39) S1679R probably damaging Het
Scn1a A C 2: 66,165,800 (GRCm39) W153G probably damaging Het
Serpinb7 A G 1: 107,373,726 (GRCm39) Y114C probably damaging Het
Spag8 C T 4: 43,651,534 (GRCm39) V447M probably benign Het
St3gal2 T A 8: 111,696,185 (GRCm39) Y257N probably damaging Het
Tars1 A T 15: 11,397,282 (GRCm39) D40E probably damaging Het
Tlr3 T C 8: 45,850,851 (GRCm39) H158R probably benign Het
Tppp2 G T 14: 52,156,392 (GRCm39) V50L probably benign Het
Trrap T C 5: 144,746,994 (GRCm39) S1503P probably benign Het
Ttll4 T G 1: 74,724,550 (GRCm39) S573R probably damaging Het
Vmn2r104 A T 17: 20,249,747 (GRCm39) N841K probably damaging Het
Vmn2r3 A T 3: 64,167,068 (GRCm39) C688S probably damaging Het
Vps16 T C 2: 130,266,369 (GRCm39) probably null Het
Zfp608 G A 18: 55,032,320 (GRCm39) T540I probably benign Het
Zfp775 G A 6: 48,596,750 (GRCm39) R208Q probably damaging Het
Other mutations in Son
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Son APN 16 91,461,210 (GRCm39) missense probably damaging 0.99
IGL01024:Son APN 16 91,452,798 (GRCm39) missense probably damaging 1.00
IGL01066:Son APN 16 91,457,024 (GRCm39) intron probably benign
IGL01083:Son APN 16 91,454,279 (GRCm39) missense probably damaging 1.00
IGL01115:Son APN 16 91,456,346 (GRCm39) missense probably benign 0.31
IGL01467:Son APN 16 91,454,165 (GRCm39) missense possibly damaging 0.93
IGL01506:Son APN 16 91,454,174 (GRCm39) missense possibly damaging 0.67
IGL01933:Son APN 16 91,454,903 (GRCm39) missense probably benign 0.00
IGL02156:Son APN 16 91,452,992 (GRCm39) missense possibly damaging 0.93
IGL02473:Son APN 16 91,455,683 (GRCm39) missense probably damaging 0.99
IGL02498:Son APN 16 91,453,713 (GRCm39) missense probably damaging 0.99
IGL02517:Son APN 16 91,452,099 (GRCm39) missense possibly damaging 0.92
IGL02530:Son APN 16 91,455,359 (GRCm39) missense possibly damaging 0.50
IGL02865:Son APN 16 91,448,640 (GRCm39) missense probably damaging 1.00
IGL03180:Son APN 16 91,453,896 (GRCm39) missense probably damaging 1.00
R0013:Son UTSW 16 91,448,550 (GRCm39) missense probably damaging 1.00
R0036:Son UTSW 16 91,457,054 (GRCm39) intron probably benign
R0037:Son UTSW 16 91,461,616 (GRCm39) missense probably damaging 1.00
R0041:Son UTSW 16 91,456,221 (GRCm39) missense probably damaging 1.00
R0048:Son UTSW 16 91,455,865 (GRCm39) missense possibly damaging 0.94
R0048:Son UTSW 16 91,455,865 (GRCm39) missense possibly damaging 0.94
R0056:Son UTSW 16 91,475,043 (GRCm39) missense possibly damaging 0.86
R0227:Son UTSW 16 91,453,761 (GRCm39) missense probably damaging 0.99
R0256:Son UTSW 16 91,453,472 (GRCm39) missense possibly damaging 0.95
R0302:Son UTSW 16 91,453,032 (GRCm39) missense probably damaging 1.00
R0815:Son UTSW 16 91,452,372 (GRCm39) missense probably damaging 0.98
R1225:Son UTSW 16 91,454,228 (GRCm39) missense probably damaging 1.00
R1255:Son UTSW 16 91,461,583 (GRCm39) missense probably damaging 1.00
R1457:Son UTSW 16 91,453,974 (GRCm39) missense probably damaging 1.00
R1459:Son UTSW 16 91,452,230 (GRCm39) missense possibly damaging 0.93
R1535:Son UTSW 16 91,456,622 (GRCm39) missense probably damaging 0.99
R1587:Son UTSW 16 91,456,606 (GRCm39) missense probably damaging 1.00
R1605:Son UTSW 16 91,454,552 (GRCm39) missense probably damaging 1.00
R1629:Son UTSW 16 91,454,510 (GRCm39) missense probably damaging 1.00
R1711:Son UTSW 16 91,457,114 (GRCm39) intron probably benign
R2138:Son UTSW 16 91,456,260 (GRCm39) missense possibly damaging 0.95
R2245:Son UTSW 16 91,444,848 (GRCm39) splice site probably null
R2351:Son UTSW 16 91,454,547 (GRCm39) missense probably damaging 0.98
R2434:Son UTSW 16 91,451,575 (GRCm39) missense probably damaging 1.00
R2870:Son UTSW 16 91,461,205 (GRCm39) splice site probably null
R2871:Son UTSW 16 91,461,205 (GRCm39) splice site probably null
R2872:Son UTSW 16 91,461,205 (GRCm39) splice site probably null
R2889:Son UTSW 16 91,456,787 (GRCm39) unclassified probably benign
R3712:Son UTSW 16 91,453,614 (GRCm39) missense probably damaging 0.99
R3913:Son UTSW 16 91,456,999 (GRCm39) intron probably benign
R4172:Son UTSW 16 91,456,250 (GRCm39) missense probably damaging 1.00
R4301:Son UTSW 16 91,455,299 (GRCm39) missense possibly damaging 0.53
R4302:Son UTSW 16 91,455,299 (GRCm39) missense possibly damaging 0.53
R4770:Son UTSW 16 91,455,756 (GRCm39) missense probably damaging 0.96
R4881:Son UTSW 16 91,472,397 (GRCm39) missense probably benign 0.31
R5020:Son UTSW 16 91,453,263 (GRCm39) missense probably damaging 1.00
R5032:Son UTSW 16 91,454,552 (GRCm39) missense probably damaging 1.00
R5151:Son UTSW 16 91,452,587 (GRCm39) missense probably damaging 1.00
R5153:Son UTSW 16 91,451,910 (GRCm39) missense possibly damaging 0.86
R5215:Son UTSW 16 91,453,563 (GRCm39) missense probably damaging 0.99
R5243:Son UTSW 16 91,451,621 (GRCm39) missense probably damaging 1.00
R5354:Son UTSW 16 91,452,627 (GRCm39) missense probably damaging 0.99
R5529:Son UTSW 16 91,452,354 (GRCm39) missense probably damaging 1.00
R5696:Son UTSW 16 91,468,301 (GRCm39) missense possibly damaging 0.67
R5763:Son UTSW 16 91,454,378 (GRCm39) missense probably damaging 1.00
R5766:Son UTSW 16 91,461,875 (GRCm39) intron probably benign
R5788:Son UTSW 16 91,456,940 (GRCm39) intron probably benign
R6314:Son UTSW 16 91,457,298 (GRCm39) intron probably benign
R6371:Son UTSW 16 91,471,629 (GRCm39)
R6429:Son UTSW 16 91,455,054 (GRCm39) missense probably benign 0.33
R6451:Son UTSW 16 91,454,490 (GRCm39) missense probably damaging 0.99
R6489:Son UTSW 16 91,452,044 (GRCm39) missense possibly damaging 0.70
R6513:Son UTSW 16 91,456,835 (GRCm39) intron probably benign
R6753:Son UTSW 16 91,454,076 (GRCm39) missense probably damaging 0.99
R6916:Son UTSW 16 91,451,673 (GRCm39) missense probably damaging 0.97
R7070:Son UTSW 16 91,453,729 (GRCm39) unclassified probably benign
R7079:Son UTSW 16 91,453,729 (GRCm39) unclassified probably benign
R7110:Son UTSW 16 91,453,406 (GRCm39) missense probably benign 0.01
R7120:Son UTSW 16 91,467,414 (GRCm39) missense unknown
R7120:Son UTSW 16 91,453,579 (GRCm39) unclassified probably benign
R7167:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R7205:Son UTSW 16 91,457,183 (GRCm39) small deletion probably benign
R7208:Son UTSW 16 91,458,990 (GRCm39) missense unknown
R7219:Son UTSW 16 91,461,889 (GRCm39) missense unknown
R7249:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R7328:Son UTSW 16 91,455,278 (GRCm39) missense probably benign 0.33
R7330:Son UTSW 16 91,453,486 (GRCm39) unclassified probably benign
R7374:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R7405:Son UTSW 16 91,453,579 (GRCm39) unclassified probably benign
R7420:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R7424:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R7464:Son UTSW 16 91,453,579 (GRCm39) unclassified probably benign
R7514:Son UTSW 16 91,451,748 (GRCm39) missense probably damaging 0.99
R7555:Son UTSW 16 91,455,810 (GRCm39) missense probably damaging 0.99
R7645:Son UTSW 16 91,457,183 (GRCm39) small deletion probably benign
R7716:Son UTSW 16 91,453,579 (GRCm39) unclassified probably benign
R7718:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R7778:Son UTSW 16 91,453,416 (GRCm39) missense probably damaging 0.99
R7824:Son UTSW 16 91,453,416 (GRCm39) missense probably damaging 0.99
R7856:Son UTSW 16 91,456,146 (GRCm39) missense probably damaging 0.99
R7870:Son UTSW 16 91,453,486 (GRCm39) unclassified probably benign
R7928:Son UTSW 16 91,453,729 (GRCm39) unclassified probably benign
R7972:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R7978:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R8000:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R8192:Son UTSW 16 91,452,437 (GRCm39) missense possibly damaging 0.91
R8221:Son UTSW 16 91,453,734 (GRCm39) missense probably damaging 1.00
R8227:Son UTSW 16 91,453,579 (GRCm39) unclassified probably benign
R8233:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R8255:Son UTSW 16 91,461,824 (GRCm39) missense unknown
R8292:Son UTSW 16 91,453,545 (GRCm39) missense possibly damaging 0.93
R8407:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R8468:Son UTSW 16 91,453,579 (GRCm39) unclassified probably benign
R8495:Son UTSW 16 91,457,183 (GRCm39) small deletion probably benign
R8772:Son UTSW 16 91,454,826 (GRCm39) missense possibly damaging 0.65
R8796:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R8862:Son UTSW 16 91,453,734 (GRCm39) missense probably damaging 1.00
R8962:Son UTSW 16 91,455,057 (GRCm39) missense possibly damaging 0.91
R8972:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R8991:Son UTSW 16 91,453,608 (GRCm39) missense possibly damaging 0.95
R8991:Son UTSW 16 91,453,366 (GRCm39) missense probably benign 0.04
R9086:Son UTSW 16 91,467,418 (GRCm39) missense unknown
R9138:Son UTSW 16 91,452,006 (GRCm39) missense possibly damaging 0.80
R9232:Son UTSW 16 91,453,579 (GRCm39) unclassified probably benign
R9241:Son UTSW 16 91,454,122 (GRCm39) missense probably damaging 0.96
R9258:Son UTSW 16 91,474,570 (GRCm39) missense unknown
R9328:Son UTSW 16 91,452,645 (GRCm39) missense possibly damaging 0.67
R9420:Son UTSW 16 91,454,508 (GRCm39) missense probably damaging 0.98
R9468:Son UTSW 16 91,454,439 (GRCm39) missense possibly damaging 0.53
R9500:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R9516:Son UTSW 16 91,453,579 (GRCm39) unclassified probably benign
R9595:Son UTSW 16 91,454,241 (GRCm39) missense possibly damaging 0.73
R9679:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R9719:Son UTSW 16 91,456,440 (GRCm39) missense probably damaging 0.96
R9749:Son UTSW 16 91,453,579 (GRCm39) unclassified probably benign
R9772:Son UTSW 16 91,457,222 (GRCm39) small deletion probably benign
R9782:Son UTSW 16 91,444,838 (GRCm39) missense probably damaging 0.99
R9788:Son UTSW 16 91,453,699 (GRCm39) unclassified probably benign
RF007:Son UTSW 16 91,456,257 (GRCm39) missense possibly damaging 0.53
RF041:Son UTSW 16 91,453,579 (GRCm39) unclassified probably benign
Z1176:Son UTSW 16 91,452,689 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GCCTATTTTGGAACCAGCAG -3'
(R):5'- ACACACTGTGTTATGCTCTGC -3'

Sequencing Primer
(F):5'- TTTGGAACCAGCAGTATCAGTCC -3'
(R):5'- TGCTCTGCATCTTTAACAATTAAATG -3'
Posted On 2017-06-26