Incidental Mutation 'R5992:Pkmyt1'
ID 480920
Institutional Source Beutler Lab
Gene Symbol Pkmyt1
Ensembl Gene ENSMUSG00000023908
Gene Name protein kinase, membrane associated tyrosine/threonine 1
Synonyms Myt1
Accession Numbers
Essential gene? Probably essential (E-score: 0.953) question?
Stock # R5992 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 23945385-23955709 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 23954300 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Serine at position 360 (W360S)
Ref Sequence ENSEMBL: ENSMUSP00000024701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024701] [ENSMUST00000024702]
AlphaFold Q9ESG9
Predicted Effect probably benign
Transcript: ENSMUST00000024701
AA Change: W360S

PolyPhen 2 Score 0.186 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000024701
Gene: ENSMUSG00000023908
AA Change: W360S

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 101 347 3.4e-22 PFAM
Pfam:Pkinase 101 350 1.2e-47 PFAM
Pfam:Kinase-like 205 334 6.8e-11 PFAM
low complexity region 397 412 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000024702
SMART Domains Protein: ENSMUSP00000024702
Gene: ENSMUSG00000023909

DomainStartEndE-ValueType
Pfam:HlyIII 43 254 1e-26 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein kinase family. The encoded protein is a membrane-associated kinase that negatively regulates the G2/M transition of the cell cycle by phosphorylating and inactivating cyclin-dependent kinase 1. The activity of the encoded protein is regulated by polo-like kinase 1. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,819,549 (GRCm39) L188* probably null Het
Acod1 C T 14: 103,292,471 (GRCm39) R332C probably damaging Het
Adamts3 T A 5: 89,839,194 (GRCm39) K852M probably damaging Het
Adm A T 7: 110,226,903 (GRCm39) probably benign Het
Aff4 A G 11: 53,263,837 (GRCm39) S286G probably damaging Het
Ank2 A G 3: 126,753,300 (GRCm39) probably null Het
Aqr A T 2: 113,973,530 (GRCm39) Y427* probably null Het
Arid1b C A 17: 5,045,231 (GRCm39) probably benign Het
Arpp21 T A 9: 111,972,553 (GRCm39) R259* probably null Het
Cep290 C T 10: 100,379,183 (GRCm39) A55V possibly damaging Het
Chsy3 GT G 18: 59,309,238 (GRCm39) 163 probably null Het
Clcn2 T C 16: 20,532,404 (GRCm39) E68G possibly damaging Het
Corin T A 5: 72,473,732 (GRCm39) H699L probably benign Het
Cyld T C 8: 89,459,681 (GRCm39) Y446H probably damaging Het
Dcst1 T A 3: 89,259,883 (GRCm39) E613V probably damaging Het
Dlk1 T C 12: 109,421,507 (GRCm39) C74R probably damaging Het
Dnah12 A C 14: 26,418,496 (GRCm39) K128T probably benign Het
Dspp T A 5: 104,326,317 (GRCm39) S893R unknown Het
Dtl A T 1: 191,300,684 (GRCm39) probably null Het
F2rl1 T A 13: 95,650,778 (GRCm39) S35C probably benign Het
Fcgbp A T 7: 27,819,959 (GRCm39) Y2562F probably benign Het
Fgf10 A T 13: 118,852,044 (GRCm39) D42V probably benign Het
Gm10271 A T 10: 116,808,497 (GRCm39) F6L probably damaging Het
Gm21190 T A 5: 15,729,849 (GRCm39) E256D probably damaging Het
Gm5157 A G 7: 20,919,346 (GRCm39) S66P probably damaging Het
Hal T G 10: 93,326,778 (GRCm39) L138R probably damaging Het
Hsd17b3 T C 13: 64,207,284 (GRCm39) probably null Het
Lrrc37 A T 11: 103,504,618 (GRCm39) M2450K possibly damaging Het
Lrsam1 T C 2: 32,845,234 (GRCm39) T94A probably benign Het
Macc1 T C 12: 119,411,320 (GRCm39) V696A probably damaging Het
Magi2 G A 5: 19,432,289 (GRCm39) M1I probably null Het
Marchf7 C A 2: 60,075,564 (GRCm39) N674K probably benign Het
Mfap1b A G 2: 121,300,776 (GRCm39) V34A probably benign Het
Mob3b G A 4: 35,084,069 (GRCm39) S40L probably benign Het
Ndufs2 A T 1: 171,063,987 (GRCm39) V386E probably damaging Het
Nfic C T 10: 81,256,581 (GRCm39) A19T probably damaging Het
Nfs1 G A 2: 155,976,373 (GRCm39) R174W probably damaging Het
Nin G T 12: 70,092,298 (GRCm39) S670R possibly damaging Het
Nrxn1 T C 17: 90,930,935 (GRCm39) I754V probably benign Het
Nwd1 T C 8: 73,380,201 (GRCm39) probably null Het
Or4a39 T A 2: 89,237,223 (GRCm39) M67L probably benign Het
Or4c1 T A 2: 89,133,703 (GRCm39) T78S possibly damaging Het
Or51a6 G T 7: 102,604,216 (GRCm39) N197K probably benign Het
Pcdhgb8 A G 18: 37,896,502 (GRCm39) E524G probably damaging Het
Phlpp1 A T 1: 106,246,723 (GRCm39) R638* probably null Het
Plxnd1 C A 6: 115,944,748 (GRCm39) probably null Het
Poldip3 A T 15: 83,013,430 (GRCm39) N322K probably damaging Het
Prmt3 A T 7: 49,478,695 (GRCm39) I419L probably benign Het
Prss36 A T 7: 127,544,002 (GRCm39) V123E probably damaging Het
Prss58 A G 6: 40,874,703 (GRCm39) I46T probably damaging Het
Rac1 T C 5: 143,492,753 (GRCm39) probably benign Het
Rb1cc1 A G 1: 6,304,220 (GRCm39) Y36C probably damaging Het
Rif1 C G 2: 51,985,856 (GRCm39) L614V probably damaging Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Rp1 A T 1: 4,218,926 (GRCm39) F951L unknown Het
Rps6ka5 G T 12: 100,541,509 (GRCm39) P417T possibly damaging Het
Ryr1 A G 7: 28,767,062 (GRCm39) W2967R probably damaging Het
Sacs T A 14: 61,442,992 (GRCm39) S1679R probably damaging Het
Scn1a A C 2: 66,165,800 (GRCm39) W153G probably damaging Het
Serpinb7 A G 1: 107,373,726 (GRCm39) Y114C probably damaging Het
Son T C 16: 91,455,792 (GRCm39) M1513T probably benign Het
Spag8 C T 4: 43,651,534 (GRCm39) V447M probably benign Het
St3gal2 T A 8: 111,696,185 (GRCm39) Y257N probably damaging Het
Tars1 A T 15: 11,397,282 (GRCm39) D40E probably damaging Het
Tlr3 T C 8: 45,850,851 (GRCm39) H158R probably benign Het
Tppp2 G T 14: 52,156,392 (GRCm39) V50L probably benign Het
Trrap T C 5: 144,746,994 (GRCm39) S1503P probably benign Het
Ttll4 T G 1: 74,724,550 (GRCm39) S573R probably damaging Het
Vmn2r104 A T 17: 20,249,747 (GRCm39) N841K probably damaging Het
Vmn2r3 A T 3: 64,167,068 (GRCm39) C688S probably damaging Het
Vps16 T C 2: 130,266,369 (GRCm39) probably null Het
Zfp608 G A 18: 55,032,320 (GRCm39) T540I probably benign Het
Zfp775 G A 6: 48,596,750 (GRCm39) R208Q probably damaging Het
Other mutations in Pkmyt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03278:Pkmyt1 APN 17 23,953,221 (GRCm39) missense probably damaging 1.00
R3977:Pkmyt1 UTSW 17 23,954,305 (GRCm39) missense probably benign
R4329:Pkmyt1 UTSW 17 23,951,709 (GRCm39) missense probably damaging 1.00
R5215:Pkmyt1 UTSW 17 23,951,566 (GRCm39) missense probably benign 0.02
R6192:Pkmyt1 UTSW 17 23,953,167 (GRCm39) missense probably damaging 1.00
R6279:Pkmyt1 UTSW 17 23,951,476 (GRCm39) missense probably benign 0.03
R6344:Pkmyt1 UTSW 17 23,951,730 (GRCm39) missense possibly damaging 0.82
R6358:Pkmyt1 UTSW 17 23,952,630 (GRCm39) splice site probably null
R7096:Pkmyt1 UTSW 17 23,953,087 (GRCm39) missense probably damaging 1.00
R8174:Pkmyt1 UTSW 17 23,952,813 (GRCm39) missense probably damaging 1.00
R8257:Pkmyt1 UTSW 17 23,953,148 (GRCm39) missense probably benign 0.00
R8391:Pkmyt1 UTSW 17 23,954,013 (GRCm39) missense probably damaging 1.00
R9532:Pkmyt1 UTSW 17 23,954,691 (GRCm39) missense probably benign
X0020:Pkmyt1 UTSW 17 23,951,734 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGGACTAAGGGCCCAGTCAG -3'
(R):5'- GCCTAAAGAAAGAATGAGCCTC -3'

Sequencing Primer
(F):5'- TAAGGGCCCAGTCAGTACCC -3'
(R):5'- TCAGAAACCAAGCCTTGTGATG -3'
Posted On 2017-06-26