Incidental Mutation 'R5993:Man2b2'
ID480940
Institutional Source Beutler Lab
Gene Symbol Man2b2
Ensembl Gene ENSMUSG00000029119
Gene Namemannosidase 2, alpha B2
Synonyms135 kDa alpha-D-mannosidase
MMRRC Submission 044172-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5993 (G1)
Quality Score163.009
Status Not validated
Chromosome5
Chromosomal Location36806921-36830653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36820980 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 320 (V320A)
Ref Sequence ENSEMBL: ENSMUSP00000031002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031002]
Predicted Effect probably benign
Transcript: ENSMUST00000031002
AA Change: V320A

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000031002
Gene: ENSMUSG00000029119
AA Change: V320A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Glyco_hydro_38 28 351 4e-100 PFAM
Alpha-mann_mid 356 439 3.3e-20 SMART
Pfam:Glyco_hydro_38C 487 1013 2e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124711
SMART Domains Protein: ENSMUSP00000115495
Gene: ENSMUSG00000029119

DomainStartEndE-ValueType
Pfam:Glyco_hydro_38C 67 469 2.5e-80 PFAM
low complexity region 483 493 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 G T 15: 94,338,723 N805K probably damaging Het
Add1 A C 5: 34,601,533 S64R probably damaging Het
Akap2 A G 4: 57,855,273 K444E possibly damaging Het
Alas1 A G 9: 106,234,129 F613L probably benign Het
Ankrd17 A T 5: 90,339,672 probably benign Het
Anks3 C T 16: 4,958,137 G67D probably damaging Het
Aspm C T 1: 139,479,531 T2052I probably benign Het
Atp8b4 C T 2: 126,403,234 V332I probably benign Het
Bin2 CGGAGCTGA C 15: 100,645,020 probably null Het
Bpifb3 T A 2: 153,929,314 M382K probably benign Het
Ccdc149 C T 5: 52,402,775 R246Q probably damaging Het
Ccdc57 T C 11: 120,894,724 K462E possibly damaging Het
Cux1 T C 5: 136,363,271 T9A probably benign Het
Cyp2c23 A G 19: 44,012,360 Y362H probably damaging Het
D430041D05Rik A G 2: 104,168,067 I998T probably damaging Het
Dclre1a A C 19: 56,542,737 Y726D probably damaging Het
Dnah5 T C 15: 28,299,226 V1578A probably benign Het
Dppa4 C T 16: 48,289,346 R110* probably null Het
Drc7 T A 8: 95,074,192 V614E probably benign Het
Fam71d C A 12: 78,715,436 N12K probably damaging Het
Gcc1 G A 6: 28,424,852 probably null Het
Greb1l G A 18: 10,544,455 D1350N probably benign Het
Kcnc1 G A 7: 46,427,532 V253M probably damaging Het
Krt78 T A 15: 101,950,449 I323F probably damaging Het
Mphosph9 A T 5: 124,316,098 F112Y probably benign Het
Mrc1 A G 2: 14,305,327 T800A probably damaging Het
Mroh1 C A 15: 76,446,680 A1197E probably damaging Het
Nlrp10 A T 7: 108,927,013 H39Q probably benign Het
Nop2 C T 6: 125,144,019 T588I probably benign Het
Oxld1 A G 11: 120,457,009 S121P probably benign Het
Prox1 T A 1: 190,162,239 D3V probably damaging Het
Ptk7 T C 17: 46,565,370 T1052A probably benign Het
Rhot2 T A 17: 25,841,111 T299S probably benign Het
Rhov A G 2: 119,270,052 F235L probably damaging Het
Runx1t1 A T 4: 13,841,863 R158S probably damaging Het
Runx1t1 A T 4: 13,875,490 E431D probably benign Het
Sema3e A G 5: 14,224,293 E186G probably damaging Het
Sema5b T A 16: 35,646,202 L158H probably damaging Het
Serpina3j A G 12: 104,314,687 T40A probably benign Het
Shroom3 A T 5: 92,940,188 S185C probably damaging Het
Skint6 A T 4: 112,809,079 V1183D probably benign Het
Smg1 A G 7: 118,140,509 V3405A probably benign Het
Supt16 C A 14: 52,178,334 R357L probably damaging Het
Thrap3 A T 4: 126,175,460 probably null Het
Topaz1 T C 9: 122,749,039 L338S probably benign Het
Ttll3 T A 6: 113,398,031 Y139* probably null Het
Ttn T G 2: 76,795,907 D6641A probably damaging Het
Wwc1 T C 11: 35,852,336 D886G probably benign Het
Zc3h7a T A 16: 11,150,662 K484N probably damaging Het
Other mutations in Man2b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Man2b2 APN 5 36816143 nonsense probably null
IGL01098:Man2b2 APN 5 36815556 missense probably damaging 1.00
IGL01367:Man2b2 APN 5 36814337 nonsense probably null
IGL01781:Man2b2 APN 5 36813745 missense possibly damaging 0.80
IGL01809:Man2b2 APN 5 36814516 missense probably benign 0.01
IGL02824:Man2b2 APN 5 36821851 missense probably benign 0.09
IGL03323:Man2b2 APN 5 36818514 missense probably benign 0.07
IGL03333:Man2b2 APN 5 36816139 missense probably damaging 0.96
R0505:Man2b2 UTSW 5 36816198 missense probably benign 0.00
R0715:Man2b2 UTSW 5 36826058 missense probably benign 0.00
R1435:Man2b2 UTSW 5 36813067 missense probably damaging 0.98
R1536:Man2b2 UTSW 5 36820927 missense probably benign 0.10
R1944:Man2b2 UTSW 5 36816180 missense probably benign
R2079:Man2b2 UTSW 5 36814372 missense possibly damaging 0.64
R2475:Man2b2 UTSW 5 36807875 missense probably benign 0.01
R2924:Man2b2 UTSW 5 36824102 missense probably benign 0.01
R2925:Man2b2 UTSW 5 36824102 missense probably benign 0.01
R2938:Man2b2 UTSW 5 36820986 missense probably benign 0.27
R3777:Man2b2 UTSW 5 36815527 missense probably benign 0.00
R3778:Man2b2 UTSW 5 36815527 missense probably benign 0.00
R3982:Man2b2 UTSW 5 36813820 missense probably benign 0.10
R4618:Man2b2 UTSW 5 36817639 missense probably benign 0.06
R4822:Man2b2 UTSW 5 36815521 missense probably damaging 1.00
R5320:Man2b2 UTSW 5 36810333 missense probably damaging 1.00
R5394:Man2b2 UTSW 5 36814518 missense probably benign 0.03
R5468:Man2b2 UTSW 5 36807175 missense probably benign 0.00
R6053:Man2b2 UTSW 5 36813038 missense probably benign 0.00
R6083:Man2b2 UTSW 5 36809041 missense probably damaging 1.00
R6376:Man2b2 UTSW 5 36821034 missense probably damaging 1.00
R6669:Man2b2 UTSW 5 36810358 missense probably benign 0.00
R7000:Man2b2 UTSW 5 36821869 missense probably damaging 1.00
R7108:Man2b2 UTSW 5 36815485 missense probably benign 0.04
R7376:Man2b2 UTSW 5 36813378 missense probably damaging 1.00
R7478:Man2b2 UTSW 5 36810313 missense probably damaging 1.00
R7712:Man2b2 UTSW 5 36810314 missense probably benign 0.00
R8059:Man2b2 UTSW 5 36816160 missense probably damaging 1.00
X0022:Man2b2 UTSW 5 36813892 missense probably damaging 0.99
Z1088:Man2b2 UTSW 5 36815356 missense possibly damaging 0.46
Z1177:Man2b2 UTSW 5 36813797 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCTGTTTAGGTGGGAAGAGC -3'
(R):5'- CAGTGATAAGCCCTCTTGCCTG -3'

Sequencing Primer
(F):5'- GGTACTCCTCACCCCTGAAC -3'
(R):5'- CCCTCTTGCCTGGGAGAG -3'
Posted On2017-06-26