Mutagenetix > Incidental Mutation

Incidental Mutation 'R5993:Mphosph9'

480944

Institutional Source

Beutler Lab

Gene Symbol

Mphosph9

Ensembl Gene

ENSMUSG00000038126

Gene Name

M-phase phosphoprotein 9

Synonyms

MPP-9, MPP9, B930097C17Rik, 9630025B04Rik, 4930548D04Rik

MMRRC Submission

044172-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5993 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

124250959-124327972 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 124316098 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Tyrosine at position 112 (F112Y)

Ref Sequence

ENSEMBL: ENSMUSP00000138982 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031344] [ENSMUST00000130502] [ENSMUST00000141203] [ENSMUST00000147737] [ENSMUST00000184951]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000031344

SMART Domains

Protein: ENSMUSP00000031344
Gene: ENSMUSG00000038126

Domain	Start	End	E-Value	Type
low complexity region	102	119	N/A	INTRINSIC
low complexity region	128	140	N/A	INTRINSIC
low complexity region	414	428	N/A	INTRINSIC
coiled coil region	574	736	N/A	INTRINSIC
low complexity region	879	898	N/A	INTRINSIC
low complexity region	957	971	N/A	INTRINSIC
coiled coil region	1040	1105	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000130502
AA Change: S61T

SMART Domains

Protein: ENSMUSP00000120827
Gene: ENSMUSG00000038126
AA Change: S61T

Domain	Start	End	E-Value	Type
low complexity region	47	74	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000141203

Predicted Effect

probably benign
Transcript: ENSMUST00000147737

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149933

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156013

Predicted Effect

probably benign
Transcript: ENSMUST00000184951
AA Change: F112Y

PolyPhen 2 Score 0.397 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000138982
Gene: ENSMUSG00000038126
AA Change: F112Y

Domain	Start	End	E-Value	Type
coiled coil region	102	130	N/A	INTRINSIC
low complexity region	132	149	N/A	INTRINSIC
low complexity region	158	170	N/A	INTRINSIC
low complexity region	444	458	N/A	INTRINSIC
coiled coil region	604	766	N/A	INTRINSIC
low complexity region	909	928	N/A	INTRINSIC
low complexity region	987	1001	N/A	INTRINSIC
coiled coil region	1070	1135	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.3%
20x: 91.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts20	G	T	15: 94,338,723	N805K	probably damaging	Het
Add1	A	C	5: 34,601,533	S64R	probably damaging	Het
Akap2	A	G	4: 57,855,273	K444E	possibly damaging	Het
Alas1	A	G	9: 106,234,129	F613L	probably benign	Het
Ankrd17	A	T	5: 90,339,672		probably benign	Het
Anks3	C	T	16: 4,958,137	G67D	probably damaging	Het
Aspm	C	T	1: 139,479,531	T2052I	probably benign	Het
Atp8b4	C	T	2: 126,403,234	V332I	probably benign	Het
Bin2	CGGAGCTGA	C	15: 100,645,020		probably null	Het
Bpifb3	T	A	2: 153,929,314	M382K	probably benign	Het
Ccdc149	C	T	5: 52,402,775	R246Q	probably damaging	Het
Ccdc57	T	C	11: 120,894,724	K462E	possibly damaging	Het
Cux1	T	C	5: 136,363,271	T9A	probably benign	Het
Cyp2c23	A	G	19: 44,012,360	Y362H	probably damaging	Het
D430041D05Rik	A	G	2: 104,168,067	I998T	probably damaging	Het
Dclre1a	A	C	19: 56,542,737	Y726D	probably damaging	Het
Dnah5	T	C	15: 28,299,226	V1578A	probably benign	Het
Dppa4	C	T	16: 48,289,346	R110*	probably null	Het
Drc7	T	A	8: 95,074,192	V614E	probably benign	Het
Fam71d	C	A	12: 78,715,436	N12K	probably damaging	Het
Gcc1	G	A	6: 28,424,852		probably null	Het
Greb1l	G	A	18: 10,544,455	D1350N	probably benign	Het
Kcnc1	G	A	7: 46,427,532	V253M	probably damaging	Het
Krt78	T	A	15: 101,950,449	I323F	probably damaging	Het
Man2b2	A	G	5: 36,820,980	V320A	probably benign	Het
Mrc1	A	G	2: 14,305,327	T800A	probably damaging	Het
Mroh1	C	A	15: 76,446,680	A1197E	probably damaging	Het
Nlrp10	A	T	7: 108,927,013	H39Q	probably benign	Het
Nop2	C	T	6: 125,144,019	T588I	probably benign	Het
Oxld1	A	G	11: 120,457,009	S121P	probably benign	Het
Prox1	T	A	1: 190,162,239	D3V	probably damaging	Het
Ptk7	T	C	17: 46,565,370	T1052A	probably benign	Het
Rhot2	T	A	17: 25,841,111	T299S	probably benign	Het
Rhov	A	G	2: 119,270,052	F235L	probably damaging	Het
Runx1t1	A	T	4: 13,841,863	R158S	probably damaging	Het
Runx1t1	A	T	4: 13,875,490	E431D	probably benign	Het
Sema3e	A	G	5: 14,224,293	E186G	probably damaging	Het
Sema5b	T	A	16: 35,646,202	L158H	probably damaging	Het
Serpina3j	A	G	12: 104,314,687	T40A	probably benign	Het
Shroom3	A	T	5: 92,940,188	S185C	probably damaging	Het
Skint6	A	T	4: 112,809,079	V1183D	probably benign	Het
Smg1	A	G	7: 118,140,509	V3405A	probably benign	Het
Supt16	C	A	14: 52,178,334	R357L	probably damaging	Het
Thrap3	A	T	4: 126,175,460		probably null	Het
Topaz1	T	C	9: 122,749,039	L338S	probably benign	Het
Ttll3	T	A	6: 113,398,031	Y139*	probably null	Het
Ttn	T	G	2: 76,795,907	D6641A	probably damaging	Het
Wwc1	T	C	11: 35,852,336	D886G	probably benign	Het
Zc3h7a	T	A	16: 11,150,662	K484N	probably damaging	Het

Other mutations in Mphosph9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01363:Mphosph9	APN	5	124262021	missense	probably damaging	1.00
IGL01527:Mphosph9	APN	5	124283624	splice site	probably benign
IGL01784:Mphosph9	APN	5	124265310	splice site	probably benign
IGL01958:Mphosph9	APN	5	124324990	utr 5 prime	probably benign
IGL02020:Mphosph9	APN	5	124258950	missense	probably damaging	0.99
IGL02190:Mphosph9	APN	5	124265425	missense	possibly damaging	0.92
IGL02261:Mphosph9	APN	5	124260087	missense	probably damaging	1.00
IGL02569:Mphosph9	APN	5	124297571	nonsense	probably null
IGL02640:Mphosph9	APN	5	124315500	missense	possibly damaging	0.66
IGL02702:Mphosph9	APN	5	124259989	missense	probably damaging	1.00
IGL02793:Mphosph9	APN	5	124283737	critical splice acceptor site	probably null
IGL02813:Mphosph9	APN	5	124315628	missense	probably benign	0.37
IGL02875:Mphosph9	APN	5	124283737	critical splice acceptor site	probably null
IGL03149:Mphosph9	APN	5	124263011	missense	probably damaging	1.00
PIT4445001:Mphosph9	UTSW	5	124298790	missense	possibly damaging	0.82
R0304:Mphosph9	UTSW	5	124298829	missense	probably benign	0.01
R0437:Mphosph9	UTSW	5	124315568	missense	probably benign	0.27
R0483:Mphosph9	UTSW	5	124306970	nonsense	probably null
R0811:Mphosph9	UTSW	5	124298759	missense	probably damaging	1.00
R0812:Mphosph9	UTSW	5	124298759	missense	probably damaging	1.00
R0942:Mphosph9	UTSW	5	124262037	nonsense	probably null
R1175:Mphosph9	UTSW	5	124315676	missense	possibly damaging	0.94
R1372:Mphosph9	UTSW	5	124283745	splice site	probably null
R1442:Mphosph9	UTSW	5	124265398	missense	possibly damaging	0.62
R1533:Mphosph9	UTSW	5	124267141	missense	probably damaging	1.00
R1959:Mphosph9	UTSW	5	124315701	missense	possibly damaging	0.92
R2036:Mphosph9	UTSW	5	124304211	missense	probably damaging	0.97
R2256:Mphosph9	UTSW	5	124283659	missense	probably benign	0.00
R2919:Mphosph9	UTSW	5	124261006	missense	probably benign	0.22
R2920:Mphosph9	UTSW	5	124261006	missense	probably benign	0.22
R4064:Mphosph9	UTSW	5	124290917	missense	probably damaging	1.00
R4272:Mphosph9	UTSW	5	124304203	missense	probably damaging	0.96
R4430:Mphosph9	UTSW	5	124265446	missense	possibly damaging	0.83
R4883:Mphosph9	UTSW	5	124299045	missense	probably damaging	1.00
R4992:Mphosph9	UTSW	5	124304190	missense	probably damaging	1.00
R5815:Mphosph9	UTSW	5	124315418	missense	probably damaging	1.00
R6102:Mphosph9	UTSW	5	124297709	missense	possibly damaging	0.86
R6295:Mphosph9	UTSW	5	124320915	missense	possibly damaging	0.46
R6320:Mphosph9	UTSW	5	124324961	missense	probably damaging	0.99
R6628:Mphosph9	UTSW	5	124298762	missense	probably damaging	0.98
R6692:Mphosph9	UTSW	5	124260116	missense	probably damaging	1.00
R6705:Mphosph9	UTSW	5	124290964	missense	possibly damaging	0.83
R6747:Mphosph9	UTSW	5	124297699	missense	possibly damaging	0.93
R6787:Mphosph9	UTSW	5	124261027	missense	probably damaging	0.99
R6850:Mphosph9	UTSW	5	124260956	missense	probably damaging	1.00
R6956:Mphosph9	UTSW	5	124297558	missense	probably damaging	1.00
R7075:Mphosph9	UTSW	5	124320859	missense	probably damaging	0.99
R7604:Mphosph9	UTSW	5	124316117	missense	probably benign	0.01
R7789:Mphosph9	UTSW	5	124315587	missense	probably damaging	1.00
R7808:Mphosph9	UTSW	5	124260946	missense	probably damaging	0.99
R7823:Mphosph9	UTSW	5	124304256	missense	probably damaging	0.99
R7891:Mphosph9	UTSW	5	124290904	missense	probably damaging	1.00
R8210:Mphosph9	UTSW	5	124267111	missense	probably damaging	1.00
R8256:Mphosph9	UTSW	5	124255106	missense	probably damaging	1.00
R8385:Mphosph9	UTSW	5	124312722	missense	probably benign	0.19
R8438:Mphosph9	UTSW	5	124292392	missense	probably benign	0.19
R8692:Mphosph9	UTSW	5	124312812	missense	probably damaging	0.99
R8790:Mphosph9	UTSW	5	124315673	missense	probably damaging	1.00
R8818:Mphosph9	UTSW	5	124324964	nonsense	probably null
R8847:Mphosph9	UTSW	5	124316146	missense	possibly damaging	0.91
R9018:Mphosph9	UTSW	5	124298650	missense	probably benign	0.12
R9208:Mphosph9	UTSW	5	124312791	missense	probably damaging	0.97
R9221:Mphosph9	UTSW	5	124265364	missense	probably benign	0.10
R9603:Mphosph9	UTSW	5	124324952	nonsense	probably null
R9721:Mphosph9	UTSW	5	124298675	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- CCTGTATTCGCTGAGAACAAAG -3'
(R):5'- ACCCAGATGGCAGGTTACATC -3'

Sequencing Primer
(F):5'- TTCGCTGAGAACAAAGAGGGTAAAG -3'
(R):5'- GGTACCTGTAATCCCAGAATTGG -3'

Posted On

2017-06-26