Incidental Mutation 'R5993:Mphosph9'
ID 480944
Institutional Source Beutler Lab
Gene Symbol Mphosph9
Ensembl Gene ENSMUSG00000038126
Gene Name M-phase phosphoprotein 9
Synonyms 4930548D04Rik, MPP9, B930097C17Rik, 9630025B04Rik, MPP-9
MMRRC Submission 044172-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5993 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 124389022-124466001 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 124454161 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 112 (F112Y)
Ref Sequence ENSEMBL: ENSMUSP00000138982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031344] [ENSMUST00000130502] [ENSMUST00000141203] [ENSMUST00000147737] [ENSMUST00000184951]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000031344
SMART Domains Protein: ENSMUSP00000031344
Gene: ENSMUSG00000038126

DomainStartEndE-ValueType
low complexity region 102 119 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
coiled coil region 574 736 N/A INTRINSIC
low complexity region 879 898 N/A INTRINSIC
low complexity region 957 971 N/A INTRINSIC
coiled coil region 1040 1105 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000130502
AA Change: S61T
SMART Domains Protein: ENSMUSP00000120827
Gene: ENSMUSG00000038126
AA Change: S61T

DomainStartEndE-ValueType
low complexity region 47 74 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141203
Predicted Effect probably benign
Transcript: ENSMUST00000147737
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149933
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156013
Predicted Effect probably benign
Transcript: ENSMUST00000184951
AA Change: F112Y

PolyPhen 2 Score 0.397 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000138982
Gene: ENSMUSG00000038126
AA Change: F112Y

DomainStartEndE-ValueType
coiled coil region 102 130 N/A INTRINSIC
low complexity region 132 149 N/A INTRINSIC
low complexity region 158 170 N/A INTRINSIC
low complexity region 444 458 N/A INTRINSIC
coiled coil region 604 766 N/A INTRINSIC
low complexity region 909 928 N/A INTRINSIC
low complexity region 987 1001 N/A INTRINSIC
coiled coil region 1070 1135 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 G T 15: 94,236,604 (GRCm39) N805K probably damaging Het
Add1 A C 5: 34,758,877 (GRCm39) S64R probably damaging Het
Alas1 A G 9: 106,111,328 (GRCm39) F613L probably benign Het
Ankrd17 A T 5: 90,487,531 (GRCm39) probably benign Het
Anks3 C T 16: 4,776,001 (GRCm39) G67D probably damaging Het
Aspm C T 1: 139,407,269 (GRCm39) T2052I probably benign Het
Atp8b4 C T 2: 126,245,154 (GRCm39) V332I probably benign Het
Bin2 CGGAGCTGA C 15: 100,542,901 (GRCm39) probably null Het
Bpifb3 T A 2: 153,771,234 (GRCm39) M382K probably benign Het
Ccdc149 C T 5: 52,560,117 (GRCm39) R246Q probably damaging Het
Ccdc57 T C 11: 120,785,550 (GRCm39) K462E possibly damaging Het
Cux1 T C 5: 136,392,125 (GRCm39) T9A probably benign Het
Cyp2c23 A G 19: 44,000,799 (GRCm39) Y362H probably damaging Het
D430041D05Rik A G 2: 103,998,412 (GRCm39) I998T probably damaging Het
Dclre1a A C 19: 56,531,169 (GRCm39) Y726D probably damaging Het
Dnah5 T C 15: 28,299,372 (GRCm39) V1578A probably benign Het
Dppa4 C T 16: 48,109,709 (GRCm39) R110* probably null Het
Drc7 T A 8: 95,800,820 (GRCm39) V614E probably benign Het
Garin2 C A 12: 78,762,210 (GRCm39) N12K probably damaging Het
Gcc1 G A 6: 28,424,851 (GRCm39) probably null Het
Greb1l G A 18: 10,544,455 (GRCm39) D1350N probably benign Het
Kcnc1 G A 7: 46,076,956 (GRCm39) V253M probably damaging Het
Krt78 T A 15: 101,858,884 (GRCm39) I323F probably damaging Het
Man2b2 A G 5: 36,978,324 (GRCm39) V320A probably benign Het
Mrc1 A G 2: 14,310,138 (GRCm39) T800A probably damaging Het
Mroh1 C A 15: 76,330,880 (GRCm39) A1197E probably damaging Het
Nlrp10 A T 7: 108,526,220 (GRCm39) H39Q probably benign Het
Nop2 C T 6: 125,120,982 (GRCm39) T588I probably benign Het
Oxld1 A G 11: 120,347,835 (GRCm39) S121P probably benign Het
Pakap A G 4: 57,855,273 (GRCm39) K444E possibly damaging Het
Prox1 T A 1: 189,894,436 (GRCm39) D3V probably damaging Het
Ptk7 T C 17: 46,876,296 (GRCm39) T1052A probably benign Het
Rhot2 T A 17: 26,060,085 (GRCm39) T299S probably benign Het
Rhov A G 2: 119,100,533 (GRCm39) F235L probably damaging Het
Runx1t1 A T 4: 13,841,863 (GRCm39) R158S probably damaging Het
Runx1t1 A T 4: 13,875,490 (GRCm39) E431D probably benign Het
Sema3e A G 5: 14,274,307 (GRCm39) E186G probably damaging Het
Sema5b T A 16: 35,466,572 (GRCm39) L158H probably damaging Het
Serpina3j A G 12: 104,280,946 (GRCm39) T40A probably benign Het
Shroom3 A T 5: 93,088,047 (GRCm39) S185C probably damaging Het
Skint6 A T 4: 112,666,276 (GRCm39) V1183D probably benign Het
Smg1 A G 7: 117,739,732 (GRCm39) V3405A probably benign Het
Supt16 C A 14: 52,415,791 (GRCm39) R357L probably damaging Het
Thrap3 A T 4: 126,069,253 (GRCm39) probably null Het
Topaz1 T C 9: 122,578,104 (GRCm39) L338S probably benign Het
Ttll3 T A 6: 113,374,992 (GRCm39) Y139* probably null Het
Ttn T G 2: 76,626,251 (GRCm39) D6641A probably damaging Het
Wwc1 T C 11: 35,743,163 (GRCm39) D886G probably benign Het
Zc3h7a T A 16: 10,968,526 (GRCm39) K484N probably damaging Het
Other mutations in Mphosph9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Mphosph9 APN 5 124,400,084 (GRCm39) missense probably damaging 1.00
IGL01527:Mphosph9 APN 5 124,421,687 (GRCm39) splice site probably benign
IGL01784:Mphosph9 APN 5 124,403,373 (GRCm39) splice site probably benign
IGL01958:Mphosph9 APN 5 124,463,053 (GRCm39) utr 5 prime probably benign
IGL02020:Mphosph9 APN 5 124,397,013 (GRCm39) missense probably damaging 0.99
IGL02190:Mphosph9 APN 5 124,403,488 (GRCm39) missense possibly damaging 0.92
IGL02261:Mphosph9 APN 5 124,398,150 (GRCm39) missense probably damaging 1.00
IGL02569:Mphosph9 APN 5 124,435,634 (GRCm39) nonsense probably null
IGL02640:Mphosph9 APN 5 124,453,563 (GRCm39) missense possibly damaging 0.66
IGL02702:Mphosph9 APN 5 124,398,052 (GRCm39) missense probably damaging 1.00
IGL02793:Mphosph9 APN 5 124,421,800 (GRCm39) critical splice acceptor site probably null
IGL02813:Mphosph9 APN 5 124,453,691 (GRCm39) missense probably benign 0.37
IGL02875:Mphosph9 APN 5 124,421,800 (GRCm39) critical splice acceptor site probably null
IGL03149:Mphosph9 APN 5 124,401,074 (GRCm39) missense probably damaging 1.00
PIT4445001:Mphosph9 UTSW 5 124,436,853 (GRCm39) missense possibly damaging 0.82
R0304:Mphosph9 UTSW 5 124,436,892 (GRCm39) missense probably benign 0.01
R0437:Mphosph9 UTSW 5 124,453,631 (GRCm39) missense probably benign 0.27
R0483:Mphosph9 UTSW 5 124,445,033 (GRCm39) nonsense probably null
R0811:Mphosph9 UTSW 5 124,436,822 (GRCm39) missense probably damaging 1.00
R0812:Mphosph9 UTSW 5 124,436,822 (GRCm39) missense probably damaging 1.00
R0942:Mphosph9 UTSW 5 124,400,100 (GRCm39) nonsense probably null
R1175:Mphosph9 UTSW 5 124,453,739 (GRCm39) missense possibly damaging 0.94
R1372:Mphosph9 UTSW 5 124,421,808 (GRCm39) splice site probably null
R1442:Mphosph9 UTSW 5 124,403,461 (GRCm39) missense possibly damaging 0.62
R1533:Mphosph9 UTSW 5 124,405,204 (GRCm39) missense probably damaging 1.00
R1959:Mphosph9 UTSW 5 124,453,764 (GRCm39) missense possibly damaging 0.92
R2036:Mphosph9 UTSW 5 124,442,274 (GRCm39) missense probably damaging 0.97
R2256:Mphosph9 UTSW 5 124,421,722 (GRCm39) missense probably benign 0.00
R2919:Mphosph9 UTSW 5 124,399,069 (GRCm39) missense probably benign 0.22
R2920:Mphosph9 UTSW 5 124,399,069 (GRCm39) missense probably benign 0.22
R4064:Mphosph9 UTSW 5 124,428,980 (GRCm39) missense probably damaging 1.00
R4272:Mphosph9 UTSW 5 124,442,266 (GRCm39) missense probably damaging 0.96
R4430:Mphosph9 UTSW 5 124,403,509 (GRCm39) missense possibly damaging 0.83
R4883:Mphosph9 UTSW 5 124,437,108 (GRCm39) missense probably damaging 1.00
R4992:Mphosph9 UTSW 5 124,442,253 (GRCm39) missense probably damaging 1.00
R5815:Mphosph9 UTSW 5 124,453,481 (GRCm39) missense probably damaging 1.00
R6102:Mphosph9 UTSW 5 124,435,772 (GRCm39) missense possibly damaging 0.86
R6295:Mphosph9 UTSW 5 124,458,978 (GRCm39) missense possibly damaging 0.46
R6320:Mphosph9 UTSW 5 124,463,024 (GRCm39) missense probably damaging 0.99
R6628:Mphosph9 UTSW 5 124,436,825 (GRCm39) missense probably damaging 0.98
R6692:Mphosph9 UTSW 5 124,398,179 (GRCm39) missense probably damaging 1.00
R6705:Mphosph9 UTSW 5 124,429,027 (GRCm39) missense possibly damaging 0.83
R6747:Mphosph9 UTSW 5 124,435,762 (GRCm39) missense possibly damaging 0.93
R6787:Mphosph9 UTSW 5 124,399,090 (GRCm39) missense probably damaging 0.99
R6850:Mphosph9 UTSW 5 124,399,019 (GRCm39) missense probably damaging 1.00
R6956:Mphosph9 UTSW 5 124,435,621 (GRCm39) missense probably damaging 1.00
R7075:Mphosph9 UTSW 5 124,458,922 (GRCm39) missense probably damaging 0.99
R7604:Mphosph9 UTSW 5 124,454,180 (GRCm39) missense probably benign 0.01
R7789:Mphosph9 UTSW 5 124,453,650 (GRCm39) missense probably damaging 1.00
R7808:Mphosph9 UTSW 5 124,399,009 (GRCm39) missense probably damaging 0.99
R7823:Mphosph9 UTSW 5 124,442,319 (GRCm39) missense probably damaging 0.99
R7891:Mphosph9 UTSW 5 124,428,967 (GRCm39) missense probably damaging 1.00
R8210:Mphosph9 UTSW 5 124,405,174 (GRCm39) missense probably damaging 1.00
R8256:Mphosph9 UTSW 5 124,393,169 (GRCm39) missense probably damaging 1.00
R8385:Mphosph9 UTSW 5 124,450,785 (GRCm39) missense probably benign 0.19
R8438:Mphosph9 UTSW 5 124,430,455 (GRCm39) missense probably benign 0.19
R8692:Mphosph9 UTSW 5 124,450,875 (GRCm39) missense probably damaging 0.99
R8790:Mphosph9 UTSW 5 124,453,736 (GRCm39) missense probably damaging 1.00
R8818:Mphosph9 UTSW 5 124,463,027 (GRCm39) nonsense probably null
R8847:Mphosph9 UTSW 5 124,454,209 (GRCm39) missense possibly damaging 0.91
R9018:Mphosph9 UTSW 5 124,436,713 (GRCm39) missense probably benign 0.12
R9208:Mphosph9 UTSW 5 124,450,854 (GRCm39) missense probably damaging 0.97
R9221:Mphosph9 UTSW 5 124,403,427 (GRCm39) missense probably benign 0.10
R9603:Mphosph9 UTSW 5 124,463,015 (GRCm39) nonsense probably null
R9721:Mphosph9 UTSW 5 124,436,738 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CCTGTATTCGCTGAGAACAAAG -3'
(R):5'- ACCCAGATGGCAGGTTACATC -3'

Sequencing Primer
(F):5'- TTCGCTGAGAACAAAGAGGGTAAAG -3'
(R):5'- GGTACCTGTAATCCCAGAATTGG -3'
Posted On 2017-06-26