Incidental Mutation 'R5993:Cyp2c23'
ID480973
Institutional Source Beutler Lab
Gene Symbol Cyp2c23
Ensembl Gene ENSMUSG00000025197
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 23
SynonymsCyp2c44
MMRRC Submission 044172-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5993 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location44005022-44029208 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44012360 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 362 (Y362H)
Ref Sequence ENSEMBL: ENSMUSP00000148377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026211] [ENSMUST00000211830]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026211
AA Change: Y362H

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026211
Gene: ENSMUSG00000025197
AA Change: Y362H

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 34 491 2.1e-152 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211830
AA Change: Y362H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele show reduced proliferative and tubulogenic responses in lung endothelial cells, decreased tumor angiogenesis and growth of induced tumors, and high potassium-induced hypertension with decreased urinary sodium excretion and increased plasma sodium levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 G T 15: 94,338,723 N805K probably damaging Het
Add1 A C 5: 34,601,533 S64R probably damaging Het
Akap2 A G 4: 57,855,273 K444E possibly damaging Het
Alas1 A G 9: 106,234,129 F613L probably benign Het
Ankrd17 A T 5: 90,339,672 probably benign Het
Anks3 C T 16: 4,958,137 G67D probably damaging Het
Aspm C T 1: 139,479,531 T2052I probably benign Het
Atp8b4 C T 2: 126,403,234 V332I probably benign Het
Bin2 CGGAGCTGA C 15: 100,645,020 probably null Het
Bpifb3 T A 2: 153,929,314 M382K probably benign Het
Ccdc149 C T 5: 52,402,775 R246Q probably damaging Het
Ccdc57 T C 11: 120,894,724 K462E possibly damaging Het
Cux1 T C 5: 136,363,271 T9A probably benign Het
D430041D05Rik A G 2: 104,168,067 I998T probably damaging Het
Dclre1a A C 19: 56,542,737 Y726D probably damaging Het
Dnah5 T C 15: 28,299,226 V1578A probably benign Het
Dppa4 C T 16: 48,289,346 R110* probably null Het
Drc7 T A 8: 95,074,192 V614E probably benign Het
Fam71d C A 12: 78,715,436 N12K probably damaging Het
Gcc1 G A 6: 28,424,852 probably null Het
Greb1l G A 18: 10,544,455 D1350N probably benign Het
Kcnc1 G A 7: 46,427,532 V253M probably damaging Het
Krt78 T A 15: 101,950,449 I323F probably damaging Het
Man2b2 A G 5: 36,820,980 V320A probably benign Het
Mphosph9 A T 5: 124,316,098 F112Y probably benign Het
Mrc1 A G 2: 14,305,327 T800A probably damaging Het
Mroh1 C A 15: 76,446,680 A1197E probably damaging Het
Nlrp10 A T 7: 108,927,013 H39Q probably benign Het
Nop2 C T 6: 125,144,019 T588I probably benign Het
Oxld1 A G 11: 120,457,009 S121P probably benign Het
Prox1 T A 1: 190,162,239 D3V probably damaging Het
Ptk7 T C 17: 46,565,370 T1052A probably benign Het
Rhot2 T A 17: 25,841,111 T299S probably benign Het
Rhov A G 2: 119,270,052 F235L probably damaging Het
Runx1t1 A T 4: 13,841,863 R158S probably damaging Het
Runx1t1 A T 4: 13,875,490 E431D probably benign Het
Sema3e A G 5: 14,224,293 E186G probably damaging Het
Sema5b T A 16: 35,646,202 L158H probably damaging Het
Serpina3j A G 12: 104,314,687 T40A probably benign Het
Shroom3 A T 5: 92,940,188 S185C probably damaging Het
Skint6 A T 4: 112,809,079 V1183D probably benign Het
Smg1 A G 7: 118,140,509 V3405A probably benign Het
Supt16 C A 14: 52,178,334 R357L probably damaging Het
Thrap3 A T 4: 126,175,460 probably null Het
Topaz1 T C 9: 122,749,039 L338S probably benign Het
Ttll3 T A 6: 113,398,031 Y139* probably null Het
Ttn T G 2: 76,795,907 D6641A probably damaging Het
Wwc1 T C 11: 35,852,336 D886G probably benign Het
Zc3h7a T A 16: 11,150,662 K484N probably damaging Het
Other mutations in Cyp2c23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01467:Cyp2c23 APN 19 44015073 missense possibly damaging 0.94
IGL01642:Cyp2c23 APN 19 44005556 missense probably damaging 1.00
IGL01782:Cyp2c23 APN 19 44029115 missense possibly damaging 0.77
IGL01843:Cyp2c23 APN 19 44005607 missense probably benign 0.02
IGL02902:Cyp2c23 APN 19 44021558 splice site probably benign
IGL03382:Cyp2c23 APN 19 44014932 missense probably damaging 0.99
R0196:Cyp2c23 UTSW 19 44012356 missense probably damaging 0.98
R0735:Cyp2c23 UTSW 19 44016810 missense probably damaging 1.00
R1384:Cyp2c23 UTSW 19 44013663 missense probably damaging 1.00
R1495:Cyp2c23 UTSW 19 44005508 missense probably benign 0.07
R1809:Cyp2c23 UTSW 19 44021558 splice site probably benign
R1872:Cyp2c23 UTSW 19 44005551 nonsense probably null
R2866:Cyp2c23 UTSW 19 44005446 missense probably damaging 1.00
R3801:Cyp2c23 UTSW 19 44007039 missense probably benign 0.11
R4234:Cyp2c23 UTSW 19 44029165 missense unknown
R4748:Cyp2c23 UTSW 19 44016737 splice site probably null
R4948:Cyp2c23 UTSW 19 44021699 missense possibly damaging 0.49
R5101:Cyp2c23 UTSW 19 44029183 missense unknown
R5420:Cyp2c23 UTSW 19 44015664 critical splice donor site probably null
R5770:Cyp2c23 UTSW 19 44021579 missense probably damaging 0.99
R6254:Cyp2c23 UTSW 19 44005463 missense probably benign 0.03
R6269:Cyp2c23 UTSW 19 44029187 start codon destroyed unknown
R6610:Cyp2c23 UTSW 19 44007081 missense probably damaging 1.00
R7344:Cyp2c23 UTSW 19 44021737 splice site probably null
R7603:Cyp2c23 UTSW 19 44014930 missense probably damaging 1.00
R8054:Cyp2c23 UTSW 19 44007116 missense probably damaging 0.99
R8098:Cyp2c23 UTSW 19 44015803 missense probably benign 0.29
R8157:Cyp2c23 UTSW 19 44021627 missense probably benign 0.00
R8813:Cyp2c23 UTSW 19 44013615 missense probably benign 0.07
X0065:Cyp2c23 UTSW 19 44029171 missense unknown
Predicted Primers PCR Primer
(F):5'- TGCCATGTTCTACAAAGCCG -3'
(R):5'- TTGCAAGTATTTCCAGGTCTCC -3'

Sequencing Primer
(F):5'- CAGAGGTAACATAATGTCTGTGGCTC -3'
(R):5'- CTGGGAATACAGGCCTGAGG -3'
Posted On2017-06-26