Incidental Mutation 'R5994:Ppp6c'
ID480979
Institutional Source Beutler Lab
Gene Symbol Ppp6c
Ensembl Gene ENSMUSG00000026753
Gene Nameprotein phosphatase 6, catalytic subunit
Synonyms
MMRRC Submission 044173-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5994 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location39194354-39226451 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 39210992 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 46 (T46K)
Ref Sequence ENSEMBL: ENSMUSP00000145064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028087] [ENSMUST00000204257] [ENSMUST00000204368] [ENSMUST00000204701]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028087
AA Change: T46K

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000028087
Gene: ENSMUSG00000026753
AA Change: T46K

DomainStartEndE-ValueType
PP2Ac 19 289 3.36e-144 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000204257
AA Change: T46K

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000145064
Gene: ENSMUSG00000026753
AA Change: T46K

DomainStartEndE-ValueType
PDB:4IYP|C 1 75 3e-14 PDB
SCOP:d1auia_ 5 57 5e-16 SMART
Blast:PP2Ac 19 74 1e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000204368
SMART Domains Protein: ENSMUSP00000145393
Gene: ENSMUSG00000026753

DomainStartEndE-ValueType
PP2Ac 1 84 2.5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204701
AA Change: T46K

PolyPhen 2 Score 0.374 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000145157
Gene: ENSMUSG00000026753
AA Change: T46K

DomainStartEndE-ValueType
PP2Ac 19 267 1.94e-117 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of protein phosphatase, a component of a signaling pathway regulating cell cycle progression. Splice variants encoding different protein isoforms exist. The pseudogene of this gene is located on chromosome X. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal embryonic development and embryonic lethality. Mice homozygous for a conditional allele activated in skin cells exhibit increased susceptibility to chemically induced skin tumors with increased proliferative and inflammatory responses in the skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,670,903 H1118L probably benign Het
Abca8b A G 11: 109,949,766 probably null Het
Abcb5 A T 12: 118,965,260 probably null Het
Adcy6 A T 15: 98,593,664 I1016N probably damaging Het
Afg3l2 A T 18: 67,429,070 C312S probably damaging Het
Ano8 C T 8: 71,484,834 V89M probably damaging Het
Arhgap21 C T 2: 20,881,376 G330D possibly damaging Het
Caskin1 T C 17: 24,496,961 L195P probably damaging Het
Cfap54 A G 10: 93,039,081 I514T probably damaging Het
Ctdsp2 G A 10: 126,995,820 probably benign Het
Cyp4x1 T C 4: 115,121,945 I152V probably benign Het
Dglucy G A 12: 100,842,700 R219Q probably benign Het
Disp3 G T 4: 148,254,284 A810E possibly damaging Het
Dtx4 T C 19: 12,501,153 Y22C probably damaging Het
Edaradd A T 13: 12,478,496 I105N probably damaging Het
Eepd1 C T 9: 25,603,453 P519S probably damaging Het
Fscn3 A T 6: 28,430,295 S155C probably benign Het
Gm10134 A T 2: 28,506,246 E51V probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Golga7 T C 8: 23,250,265 E83G probably benign Het
Gpr12 T C 5: 146,583,431 H227R probably damaging Het
Hoxa2 T G 6: 52,164,392 S85R possibly damaging Het
Hrnr T C 3: 93,332,300 S3282P unknown Het
Ift74 C A 4: 94,691,724 T543K possibly damaging Het
Klf10 C A 15: 38,296,041 R420L probably damaging Het
Krt77 T A 15: 101,862,855 I338F probably damaging Het
Limch1 A T 5: 66,974,622 S152C probably damaging Het
Mgat4e T A 1: 134,541,496 H270L probably benign Het
Myrf A T 19: 10,219,117 L504Q probably null Het
Nckipsd A G 9: 108,813,977 Q366R probably benign Het
Npy5r A T 8: 66,682,099 V14D probably benign Het
Nrap T A 19: 56,351,599 R830* probably null Het
Ogfrl1 A T 1: 23,378,989 Y103N probably damaging Het
Olfr978 A T 9: 39,994,223 R138* probably null Het
P2rx4 T A 5: 122,725,079 L232H probably damaging Het
Pabpc2 A T 18: 39,773,894 T71S probably benign Het
Paip2b C A 6: 83,808,885 S121I probably damaging Het
Pofut1 C T 2: 153,261,229 T261I possibly damaging Het
Prkd2 C A 7: 16,850,336 H371Q probably benign Het
Prrc2c A T 1: 162,674,156 probably null Het
Psd3 C T 8: 67,719,968 A894T probably damaging Het
Pygm A T 19: 6,398,043 probably null Het
Pzp A T 6: 128,491,597 M989K probably damaging Het
Ralgapa2 A T 2: 146,361,453 S1159T probably benign Het
Rapgefl1 T C 11: 98,850,160 F575L probably benign Het
Rassf6 A G 5: 90,617,768 L28S probably damaging Het
Rbp3 G T 14: 33,954,900 K268N probably damaging Het
Rela C T 19: 5,647,064 T433M possibly damaging Het
Rnf103 T A 6: 71,496,910 S102R probably damaging Het
Scarf2 A G 16: 17,806,379 N516S probably damaging Het
Sdcbp2 T C 2: 151,587,483 I241T probably damaging Het
Sept7 T C 9: 25,288,198 I131T possibly damaging Het
Sh3pxd2b T C 11: 32,407,570 F191L probably damaging Het
Siglec15 C A 18: 78,047,375 C236F probably damaging Het
Slc11a2 T C 15: 100,397,681 T520A probably benign Het
Slc26a11 C A 11: 119,379,912 F553L probably benign Het
Smchd1 G A 17: 71,365,409 P1596S possibly damaging Het
Taar7b A G 10: 24,000,348 H137R probably damaging Het
Thap12 T A 7: 98,716,030 C468* probably null Het
Timp4 C T 6: 115,247,354 G118D probably damaging Het
Tnnt3 A G 7: 142,511,266 K48E probably damaging Het
Trmt10a T A 3: 138,156,714 I255N probably damaging Het
Ttll10 T C 4: 156,048,732 probably null Het
Ube4b A G 4: 149,372,932 Y283H probably damaging Het
Ucp1 G T 8: 83,293,938 V126L possibly damaging Het
Unc13b T A 4: 43,172,596 probably benign Het
Vps13b T C 15: 35,875,772 S2768P probably damaging Het
Zcchc6 T G 13: 59,789,209 Y806S probably damaging Het
Zfp101 T A 17: 33,380,962 M607L probably benign Het
Zfp292 C T 4: 34,805,464 V2527M possibly damaging Het
Zfp503 T A 14: 21,985,562 T429S possibly damaging Het
Other mutations in Ppp6c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02066:Ppp6c APN 2 39199671 missense probably benign 0.22
IGL02551:Ppp6c APN 2 39206657 missense probably damaging 1.00
IGL02967:Ppp6c APN 2 39226217 missense probably damaging 0.98
R0399:Ppp6c UTSW 2 39200124 splice site probably benign
R0506:Ppp6c UTSW 2 39206648 intron probably benign
R2061:Ppp6c UTSW 2 39226174 missense probably damaging 0.99
R2180:Ppp6c UTSW 2 39197513 missense probably benign 0.01
R5625:Ppp6c UTSW 2 39197441 missense probably benign
R5822:Ppp6c UTSW 2 39200052 nonsense probably null
R6785:Ppp6c UTSW 2 39197581 missense probably benign 0.00
R7346:Ppp6c UTSW 2 39226217 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TATAGTGAACCAGAAACCACTCATG -3'
(R):5'- CTGTAGGCAGGCAAATGGTAC -3'

Sequencing Primer
(F):5'- TCATGGCATGACTAACACCAC -3'
(R):5'- TGGTACATGCAGGCAAAATACTC -3'
Posted On2017-06-26