Mutagenetix > Incidental Mutation

Incidental Mutation 'R5994:Ralgapa2'

480980

Institutional Source

Beutler Lab

Gene Symbol

Ralgapa2

Ensembl Gene

ENSMUSG00000037110

Gene Name

Ral GTPase activating protein, alpha subunit 2 (catalytic)

Synonyms

AS250, RGC2, A230067G21Rik

MMRRC Submission

044173-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.124) question?

Stock #

R5994 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

146239879-146512344 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 146361453 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 1159 (S1159T)

Ref Sequence

ENSEMBL: ENSMUSP00000153734 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109986] [ENSMUST00000131824] [ENSMUST00000228797]

AlphaFold

A3KGS3

Predicted Effect

probably benign
Transcript: ENSMUST00000109986
AA Change: S1112T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000105613
Gene: ENSMUSG00000037110
AA Change: S1112T

Domain	Start	End	E-Value	Type
low complexity region	469	480	N/A	INTRINSIC
low complexity region	1017	1028	N/A	INTRINSIC
low complexity region	1296	1301	N/A	INTRINSIC
Pfam:Rap_GAP	1701	1877	6.8e-48	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000131824
AA Change: S1074T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000122039
Gene: ENSMUSG00000037110
AA Change: S1074T

Domain	Start	End	E-Value	Type
low complexity region	469	480	N/A	INTRINSIC
low complexity region	979	990	N/A	INTRINSIC
low complexity region	1258	1263	N/A	INTRINSIC
Pfam:Rap_GAP	1663	1842	1.3e-66	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000146307
AA Change: S100T

SMART Domains

Protein: ENSMUSP00000114547
Gene: ENSMUSG00000037110
AA Change: S100T

Domain	Start	End	E-Value	Type
low complexity region	6	17	N/A	INTRINSIC
low complexity region	285	290	N/A	INTRINSIC
Pfam:Rap_GAP	690	830	4.9e-39	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148784

Predicted Effect

unknown
Transcript: ENSMUST00000149499
AA Change: S744T

SMART Domains

Protein: ENSMUSP00000122017
Gene: ENSMUSG00000037110
AA Change: S744T

Domain	Start	End	E-Value	Type
low complexity region	140	151	N/A	INTRINSIC
low complexity region	650	661	N/A	INTRINSIC
low complexity region	929	934	N/A	INTRINSIC
Pfam:Rap_GAP	1334	1511	2.4e-48	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000228797
AA Change: S1159T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 91.7%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased incidence and severity of induced urothelial bladder tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	A	T	6: 121,670,903	H1118L	probably benign	Het
Abca8b	A	G	11: 109,949,766		probably null	Het
Abcb5	A	T	12: 118,965,260		probably null	Het
Adcy6	A	T	15: 98,593,664	I1016N	probably damaging	Het
Afg3l2	A	T	18: 67,429,070	C312S	probably damaging	Het
Ano8	C	T	8: 71,484,834	V89M	probably damaging	Het
Arhgap21	C	T	2: 20,881,376	G330D	possibly damaging	Het
Caskin1	T	C	17: 24,496,961	L195P	probably damaging	Het
Cfap54	A	G	10: 93,039,081	I514T	probably damaging	Het
Ctdsp2	G	A	10: 126,995,820		probably benign	Het
Cyp4x1	T	C	4: 115,121,945	I152V	probably benign	Het
Dglucy	G	A	12: 100,842,700	R219Q	probably benign	Het
Disp3	G	T	4: 148,254,284	A810E	possibly damaging	Het
Dtx4	T	C	19: 12,501,153	Y22C	probably damaging	Het
Edaradd	A	T	13: 12,478,496	I105N	probably damaging	Het
Eepd1	C	T	9: 25,603,453	P519S	probably damaging	Het
Fscn3	A	T	6: 28,430,295	S155C	probably benign	Het
Gm10134	A	T	2: 28,506,246	E51V	probably damaging	Het
Gm7247	C	T	14: 51,364,348	S26F	probably benign	Het
Golga7	T	C	8: 23,250,265	E83G	probably benign	Het
Gpr12	T	C	5: 146,583,431	H227R	probably damaging	Het
Hoxa2	T	G	6: 52,164,392	S85R	possibly damaging	Het
Hrnr	T	C	3: 93,332,300	S3282P	unknown	Het
Ift74	C	A	4: 94,691,724	T543K	possibly damaging	Het
Klf10	C	A	15: 38,296,041	R420L	probably damaging	Het
Krt77	T	A	15: 101,862,855	I338F	probably damaging	Het
Limch1	A	T	5: 66,974,622	S152C	probably damaging	Het
Mgat4e	T	A	1: 134,541,496	H270L	probably benign	Het
Myrf	A	T	19: 10,219,117	L504Q	probably null	Het
Nckipsd	A	G	9: 108,813,977	Q366R	probably benign	Het
Npy5r	A	T	8: 66,682,099	V14D	probably benign	Het
Nrap	T	A	19: 56,351,599	R830*	probably null	Het
Ogfrl1	A	T	1: 23,378,989	Y103N	probably damaging	Het
Olfr978	A	T	9: 39,994,223	R138*	probably null	Het
P2rx4	T	A	5: 122,725,079	L232H	probably damaging	Het
Pabpc2	A	T	18: 39,773,894	T71S	probably benign	Het
Paip2b	C	A	6: 83,808,885	S121I	probably damaging	Het
Pofut1	C	T	2: 153,261,229	T261I	possibly damaging	Het
Ppp6c	G	T	2: 39,210,992	T46K	possibly damaging	Het
Prkd2	C	A	7: 16,850,336	H371Q	probably benign	Het
Prrc2c	A	T	1: 162,674,156		probably null	Het
Psd3	C	T	8: 67,719,968	A894T	probably damaging	Het
Pygm	A	T	19: 6,398,043		probably null	Het
Pzp	A	T	6: 128,491,597	M989K	probably damaging	Het
Rapgefl1	T	C	11: 98,850,160	F575L	probably benign	Het
Rassf6	A	G	5: 90,617,768	L28S	probably damaging	Het
Rbp3	G	T	14: 33,954,900	K268N	probably damaging	Het
Rela	C	T	19: 5,647,064	T433M	possibly damaging	Het
Rnf103	T	A	6: 71,496,910	S102R	probably damaging	Het
Scarf2	A	G	16: 17,806,379	N516S	probably damaging	Het
Sdcbp2	T	C	2: 151,587,483	I241T	probably damaging	Het
Sept7	T	C	9: 25,288,198	I131T	possibly damaging	Het
Sh3pxd2b	T	C	11: 32,407,570	F191L	probably damaging	Het
Siglec15	C	A	18: 78,047,375	C236F	probably damaging	Het
Slc11a2	T	C	15: 100,397,681	T520A	probably benign	Het
Slc26a11	C	A	11: 119,379,912	F553L	probably benign	Het
Smchd1	G	A	17: 71,365,409	P1596S	possibly damaging	Het
Taar7b	A	G	10: 24,000,348	H137R	probably damaging	Het
Thap12	T	A	7: 98,716,030	C468*	probably null	Het
Timp4	C	T	6: 115,247,354	G118D	probably damaging	Het
Tnnt3	A	G	7: 142,511,266	K48E	probably damaging	Het
Trmt10a	T	A	3: 138,156,714	I255N	probably damaging	Het
Ttll10	T	C	4: 156,048,732		probably null	Het
Ube4b	A	G	4: 149,372,932	Y283H	probably damaging	Het
Ucp1	G	T	8: 83,293,938	V126L	possibly damaging	Het
Unc13b	T	A	4: 43,172,596		probably benign	Het
Vps13b	T	C	15: 35,875,772	S2768P	probably damaging	Het
Zcchc6	T	G	13: 59,789,209	Y806S	probably damaging	Het
Zfp101	T	A	17: 33,380,962	M607L	probably benign	Het
Zfp292	C	T	4: 34,805,464	V2527M	possibly damaging	Het
Zfp503	T	A	14: 21,985,562	T429S	possibly damaging	Het

Other mutations in Ralgapa2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00666:Ralgapa2	APN	2	146485136	missense	possibly damaging	0.61
IGL00915:Ralgapa2	APN	2	146342522	missense	probably damaging	1.00
IGL01012:Ralgapa2	APN	2	146421739	missense	possibly damaging	0.95
IGL01018:Ralgapa2	APN	2	146410193	missense	probably benign	0.02
IGL01018:Ralgapa2	APN	2	146410192	missense	probably benign	0.00
IGL01902:Ralgapa2	APN	2	146315014	missense	probably damaging	1.00
IGL02160:Ralgapa2	APN	2	146348440	splice site	probably benign
IGL02321:Ralgapa2	APN	2	146412816	nonsense	probably null
IGL02412:Ralgapa2	APN	2	146412132	missense	probably damaging	0.96
IGL03026:Ralgapa2	APN	2	146460775	splice site	probably benign
IGL03115:Ralgapa2	APN	2	146424814	missense	probably damaging	0.99
IGL03256:Ralgapa2	APN	2	146460712	critical splice donor site	probably null
IGL03379:Ralgapa2	APN	2	146357987	missense	probably benign	0.01
Chow	UTSW	2	146346718	nonsense	probably null
purina	UTSW	2	146333486	missense	probably damaging	1.00
P4748:Ralgapa2	UTSW	2	146346811	nonsense	probably null
R0012:Ralgapa2	UTSW	2	146412752	missense	probably benign
R0012:Ralgapa2	UTSW	2	146412752	missense	probably benign
R0165:Ralgapa2	UTSW	2	146388487	splice site	probably benign
R0344:Ralgapa2	UTSW	2	146346794	missense	possibly damaging	0.69
R0402:Ralgapa2	UTSW	2	146434809	missense	probably damaging	0.98
R0419:Ralgapa2	UTSW	2	146428672	missense	possibly damaging	0.69
R0638:Ralgapa2	UTSW	2	146342192	missense	probably benign	0.00
R0704:Ralgapa2	UTSW	2	146451784	missense	probably damaging	1.00
R0722:Ralgapa2	UTSW	2	146388531	missense	probably damaging	1.00
R0866:Ralgapa2	UTSW	2	146436003	missense	probably damaging	1.00
R1065:Ralgapa2	UTSW	2	146450558	missense	probably benign	0.00
R1212:Ralgapa2	UTSW	2	146357982	missense	probably benign	0.00
R1395:Ralgapa2	UTSW	2	146388500	missense	probably damaging	1.00
R1614:Ralgapa2	UTSW	2	146388612	missense	probably damaging	1.00
R1686:Ralgapa2	UTSW	2	146358000	missense	probably benign	0.09
R1799:Ralgapa2	UTSW	2	146342728	missense	probably benign	0.02
R1905:Ralgapa2	UTSW	2	146387701	missense	probably damaging	1.00
R1956:Ralgapa2	UTSW	2	146460759	missense	probably benign	0.00
R2144:Ralgapa2	UTSW	2	146388604	missense	probably damaging	1.00
R2148:Ralgapa2	UTSW	2	146431887	missense	probably benign	0.02
R2219:Ralgapa2	UTSW	2	146421679	missense	probably benign	0.09
R2220:Ralgapa2	UTSW	2	146421679	missense	probably benign	0.09
R2261:Ralgapa2	UTSW	2	146342683	missense	probably damaging	1.00
R2402:Ralgapa2	UTSW	2	146353192	missense	probably damaging	1.00
R2495:Ralgapa2	UTSW	2	146361400	missense	possibly damaging	0.82
R3752:Ralgapa2	UTSW	2	146421631	missense	possibly damaging	0.94
R3953:Ralgapa2	UTSW	2	146435964	missense	probably damaging	1.00
R3956:Ralgapa2	UTSW	2	146435964	missense	probably damaging	1.00
R4177:Ralgapa2	UTSW	2	146485163	missense	probably damaging	1.00
R4182:Ralgapa2	UTSW	2	146435994	missense	probably damaging	1.00
R4193:Ralgapa2	UTSW	2	146342573	missense	probably damaging	1.00
R4332:Ralgapa2	UTSW	2	146260368	missense	probably benign	0.10
R4507:Ralgapa2	UTSW	2	146353248	missense	probably benign	0.11
R4574:Ralgapa2	UTSW	2	146435999	missense	probably damaging	1.00
R4585:Ralgapa2	UTSW	2	146315024	missense	probably damaging	0.99
R4627:Ralgapa2	UTSW	2	146361453	missense	possibly damaging	0.88
R4647:Ralgapa2	UTSW	2	146387629	missense	possibly damaging	0.69
R4677:Ralgapa2	UTSW	2	146345467	missense	possibly damaging	0.82
R4724:Ralgapa2	UTSW	2	146345533	missense	possibly damaging	0.46
R4760:Ralgapa2	UTSW	2	146346749	missense	probably benign	0.00
R4831:Ralgapa2	UTSW	2	146405067	intron	probably benign
R4962:Ralgapa2	UTSW	2	146434834	nonsense	probably null
R4993:Ralgapa2	UTSW	2	146447311	missense	probably damaging	1.00
R5041:Ralgapa2	UTSW	2	146485151	missense	probably benign	0.00
R5120:Ralgapa2	UTSW	2	146412084	missense	probably benign	0.26
R5185:Ralgapa2	UTSW	2	146388486	splice site	probably null
R5393:Ralgapa2	UTSW	2	146345455	missense	probably damaging	1.00
R5428:Ralgapa2	UTSW	2	146334494	missense	probably damaging	0.96
R5439:Ralgapa2	UTSW	2	146342510	missense	probably benign	0.08
R5476:Ralgapa2	UTSW	2	146447436	missense	probably benign
R5695:Ralgapa2	UTSW	2	146333477	missense	probably damaging	1.00
R5705:Ralgapa2	UTSW	2	146449273	missense	probably damaging	1.00
R5718:Ralgapa2	UTSW	2	146453406	splice site	probably null
R5817:Ralgapa2	UTSW	2	146333486	missense	probably damaging	1.00
R5877:Ralgapa2	UTSW	2	146388569	missense	probably damaging	1.00
R6048:Ralgapa2	UTSW	2	146434845	missense	possibly damaging	0.46
R6158:Ralgapa2	UTSW	2	146424676	missense	possibly damaging	0.69
R6169:Ralgapa2	UTSW	2	146450465	missense	probably damaging	1.00
R6280:Ralgapa2	UTSW	2	146342209	missense	probably damaging	1.00
R6301:Ralgapa2	UTSW	2	146327411	missense	possibly damaging	0.94
R6650:Ralgapa2	UTSW	2	146388502	missense	probably damaging	1.00
R6959:Ralgapa2	UTSW	2	146342701	missense	probably damaging	0.98
R7020:Ralgapa2	UTSW	2	146346718	nonsense	probably null
R7035:Ralgapa2	UTSW	2	146511857	missense	probably damaging	1.00
R7167:Ralgapa2	UTSW	2	146348454	missense	probably benign
R7186:Ralgapa2	UTSW	2	146388486	splice site	probably null
R7252:Ralgapa2	UTSW	2	146342751	critical splice acceptor site	probably null
R7266:Ralgapa2	UTSW	2	146334568	missense	probably damaging	1.00
R7371:Ralgapa2	UTSW	2	146347126	missense	probably benign	0.05
R7432:Ralgapa2	UTSW	2	146434856	missense	probably benign	0.41
R7470:Ralgapa2	UTSW	2	146424667	missense	probably damaging	1.00
R7663:Ralgapa2	UTSW	2	146418415	missense	probably benign	0.01
R7780:Ralgapa2	UTSW	2	146342414	missense	probably benign	0.14
R7973:Ralgapa2	UTSW	2	146388561	missense	possibly damaging	0.88
R8018:Ralgapa2	UTSW	2	146340391	missense	probably damaging	1.00
R8063:Ralgapa2	UTSW	2	146443855	missense	probably damaging	1.00
R8070:Ralgapa2	UTSW	2	146353279	missense	probably damaging	0.98
R8264:Ralgapa2	UTSW	2	146333450	missense	possibly damaging	0.90
R8309:Ralgapa2	UTSW	2	146404866	missense	possibly damaging	0.66
R8409:Ralgapa2	UTSW	2	146244977	missense
R8474:Ralgapa2	UTSW	2	146424830	missense	probably damaging	1.00
R8487:Ralgapa2	UTSW	2	146388543	missense	probably damaging	1.00
R8492:Ralgapa2	UTSW	2	146342604	missense	possibly damaging	0.50
R8733:Ralgapa2	UTSW	2	146424763	missense	probably damaging	1.00
R8856:Ralgapa2	UTSW	2	146342219	missense	probably benign	0.30
R8858:Ralgapa2	UTSW	2	146260365	critical splice donor site	probably null
R8862:Ralgapa2	UTSW	2	146424811	missense	probably benign	0.41
R9146:Ralgapa2	UTSW	2	146342332	missense	probably benign
R9324:Ralgapa2	UTSW	2	146460725	missense	probably damaging	1.00
R9439:Ralgapa2	UTSW	2	146412138	missense	probably benign
R9457:Ralgapa2	UTSW	2	146334554	missense	probably damaging	0.99
RF019:Ralgapa2	UTSW	2	146361503	missense	possibly damaging	0.53
X0019:Ralgapa2	UTSW	2	146388652	missense	possibly damaging	0.56
Z1088:Ralgapa2	UTSW	2	146434905	missense	probably benign	0.20

Predicted Primers

PCR Primer
(F):5'- CCCAGTTTCACATCGCACTAATG -3'
(R):5'- ACCATTGGAATTATGCATCCCC -3'

Sequencing Primer
(F):5'- TGAGTCAACACCTGTTAAGAGTG -3'
(R):5'- GGAATTATGCATCCCCCGTAC -3'

Posted On

2017-06-26