Incidental Mutation 'R5994:Ralgapa2'
ID 480980
Institutional Source Beutler Lab
Gene Symbol Ralgapa2
Ensembl Gene ENSMUSG00000037110
Gene Name Ral GTPase activating protein, alpha subunit 2 (catalytic)
Synonyms AS250, A230067G21Rik, RGC2
MMRRC Submission 044173-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.250) question?
Stock # R5994 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 146081799-146354264 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 146203373 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 1159 (S1159T)
Ref Sequence ENSEMBL: ENSMUSP00000153734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109986] [ENSMUST00000131824] [ENSMUST00000228797]
AlphaFold A3KGS3
Predicted Effect probably benign
Transcript: ENSMUST00000109986
AA Change: S1112T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105613
Gene: ENSMUSG00000037110
AA Change: S1112T

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 1017 1028 N/A INTRINSIC
low complexity region 1296 1301 N/A INTRINSIC
Pfam:Rap_GAP 1701 1877 6.8e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131824
AA Change: S1074T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122039
Gene: ENSMUSG00000037110
AA Change: S1074T

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 979 990 N/A INTRINSIC
low complexity region 1258 1263 N/A INTRINSIC
Pfam:Rap_GAP 1663 1842 1.3e-66 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000146307
AA Change: S100T
SMART Domains Protein: ENSMUSP00000114547
Gene: ENSMUSG00000037110
AA Change: S100T

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
low complexity region 285 290 N/A INTRINSIC
Pfam:Rap_GAP 690 830 4.9e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148784
Predicted Effect unknown
Transcript: ENSMUST00000149499
AA Change: S744T
SMART Domains Protein: ENSMUSP00000122017
Gene: ENSMUSG00000037110
AA Change: S744T

DomainStartEndE-ValueType
low complexity region 140 151 N/A INTRINSIC
low complexity region 650 661 N/A INTRINSIC
low complexity region 929 934 N/A INTRINSIC
Pfam:Rap_GAP 1334 1511 2.4e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228797
AA Change: S1159T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased incidence and severity of induced urothelial bladder tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,647,862 (GRCm39) H1118L probably benign Het
Abca8b A G 11: 109,840,592 (GRCm39) probably null Het
Abcb5 A T 12: 118,928,995 (GRCm39) probably null Het
Adcy6 A T 15: 98,491,545 (GRCm39) I1016N probably damaging Het
Afg3l2 A T 18: 67,562,140 (GRCm39) C312S probably damaging Het
Ano8 C T 8: 71,937,478 (GRCm39) V89M probably damaging Het
Arhgap21 C T 2: 20,886,187 (GRCm39) G330D possibly damaging Het
Caskin1 T C 17: 24,715,935 (GRCm39) L195P probably damaging Het
Cfap54 A G 10: 92,874,943 (GRCm39) I514T probably damaging Het
Ctdsp2 G A 10: 126,831,689 (GRCm39) probably benign Het
Cyp4x1 T C 4: 114,979,142 (GRCm39) I152V probably benign Het
Dglucy G A 12: 100,808,959 (GRCm39) R219Q probably benign Het
Disp3 G T 4: 148,338,741 (GRCm39) A810E possibly damaging Het
Dtx4 T C 19: 12,478,517 (GRCm39) Y22C probably damaging Het
Edaradd A T 13: 12,493,377 (GRCm39) I105N probably damaging Het
Eepd1 C T 9: 25,514,749 (GRCm39) P519S probably damaging Het
Fscn3 A T 6: 28,430,294 (GRCm39) S155C probably benign Het
Gm10134 A T 2: 28,396,258 (GRCm39) E51V probably damaging Het
Gm7247 C T 14: 51,601,805 (GRCm39) S26F probably benign Het
Golga7 T C 8: 23,740,281 (GRCm39) E83G probably benign Het
Gpr12 T C 5: 146,520,241 (GRCm39) H227R probably damaging Het
Hoxa2 T G 6: 52,141,372 (GRCm39) S85R possibly damaging Het
Hrnr T C 3: 93,239,607 (GRCm39) S3282P unknown Het
Ift74 C A 4: 94,579,961 (GRCm39) T543K possibly damaging Het
Klf10 C A 15: 38,296,285 (GRCm39) R420L probably damaging Het
Krt77 T A 15: 101,771,290 (GRCm39) I338F probably damaging Het
Limch1 A T 5: 67,131,965 (GRCm39) S152C probably damaging Het
Mgat4e T A 1: 134,469,234 (GRCm39) H270L probably benign Het
Myrf A T 19: 10,196,481 (GRCm39) L504Q probably null Het
Nckipsd A G 9: 108,691,176 (GRCm39) Q366R probably benign Het
Npy5r A T 8: 67,134,751 (GRCm39) V14D probably benign Het
Nrap T A 19: 56,340,031 (GRCm39) R830* probably null Het
Ogfrl1 A T 1: 23,418,070 (GRCm39) Y103N probably damaging Het
Or10g7 A T 9: 39,905,519 (GRCm39) R138* probably null Het
P2rx4 T A 5: 122,863,142 (GRCm39) L232H probably damaging Het
Pabpc2 A T 18: 39,906,947 (GRCm39) T71S probably benign Het
Paip2b C A 6: 83,785,867 (GRCm39) S121I probably damaging Het
Pofut1 C T 2: 153,103,149 (GRCm39) T261I possibly damaging Het
Ppp6c G T 2: 39,101,004 (GRCm39) T46K possibly damaging Het
Prkd2 C A 7: 16,584,261 (GRCm39) H371Q probably benign Het
Prrc2c A T 1: 162,501,725 (GRCm39) probably null Het
Psd3 C T 8: 68,172,620 (GRCm39) A894T probably damaging Het
Pygm A T 19: 6,448,073 (GRCm39) probably null Het
Pzp A T 6: 128,468,560 (GRCm39) M989K probably damaging Het
Rapgefl1 T C 11: 98,740,986 (GRCm39) F575L probably benign Het
Rassf6 A G 5: 90,765,627 (GRCm39) L28S probably damaging Het
Rbp3 G T 14: 33,676,857 (GRCm39) K268N probably damaging Het
Rela C T 19: 5,697,092 (GRCm39) T433M possibly damaging Het
Rnf103 T A 6: 71,473,894 (GRCm39) S102R probably damaging Het
Scarf2 A G 16: 17,624,243 (GRCm39) N516S probably damaging Het
Sdcbp2 T C 2: 151,429,403 (GRCm39) I241T probably damaging Het
Septin7 T C 9: 25,199,494 (GRCm39) I131T possibly damaging Het
Sh3pxd2b T C 11: 32,357,570 (GRCm39) F191L probably damaging Het
Siglec15 C A 18: 78,090,590 (GRCm39) C236F probably damaging Het
Slc11a2 T C 15: 100,295,562 (GRCm39) T520A probably benign Het
Slc26a11 C A 11: 119,270,738 (GRCm39) F553L probably benign Het
Smchd1 G A 17: 71,672,404 (GRCm39) P1596S possibly damaging Het
Taar7b A G 10: 23,876,246 (GRCm39) H137R probably damaging Het
Thap12 T A 7: 98,365,237 (GRCm39) C468* probably null Het
Timp4 C T 6: 115,224,315 (GRCm39) G118D probably damaging Het
Tnnt3 A G 7: 142,065,003 (GRCm39) K48E probably damaging Het
Trmt10a T A 3: 137,862,475 (GRCm39) I255N probably damaging Het
Ttll10 T C 4: 156,133,189 (GRCm39) probably null Het
Tut7 T G 13: 59,937,023 (GRCm39) Y806S probably damaging Het
Ube4b A G 4: 149,457,389 (GRCm39) Y283H probably damaging Het
Ucp1 G T 8: 84,020,567 (GRCm39) V126L possibly damaging Het
Unc13b T A 4: 43,172,596 (GRCm39) probably benign Het
Vps13b T C 15: 35,875,918 (GRCm39) S2768P probably damaging Het
Zfp101 T A 17: 33,599,936 (GRCm39) M607L probably benign Het
Zfp292 C T 4: 34,805,464 (GRCm39) V2527M possibly damaging Het
Zfp503 T A 14: 22,035,630 (GRCm39) T429S possibly damaging Het
Other mutations in Ralgapa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Ralgapa2 APN 2 146,327,056 (GRCm39) missense possibly damaging 0.61
IGL00915:Ralgapa2 APN 2 146,184,442 (GRCm39) missense probably damaging 1.00
IGL01012:Ralgapa2 APN 2 146,263,659 (GRCm39) missense possibly damaging 0.95
IGL01018:Ralgapa2 APN 2 146,252,112 (GRCm39) missense probably benign 0.00
IGL01018:Ralgapa2 APN 2 146,252,113 (GRCm39) missense probably benign 0.02
IGL01902:Ralgapa2 APN 2 146,156,934 (GRCm39) missense probably damaging 1.00
IGL02160:Ralgapa2 APN 2 146,190,360 (GRCm39) splice site probably benign
IGL02321:Ralgapa2 APN 2 146,254,736 (GRCm39) nonsense probably null
IGL02412:Ralgapa2 APN 2 146,254,052 (GRCm39) missense probably damaging 0.96
IGL03026:Ralgapa2 APN 2 146,302,695 (GRCm39) splice site probably benign
IGL03115:Ralgapa2 APN 2 146,266,734 (GRCm39) missense probably damaging 0.99
IGL03256:Ralgapa2 APN 2 146,302,632 (GRCm39) critical splice donor site probably null
IGL03379:Ralgapa2 APN 2 146,199,907 (GRCm39) missense probably benign 0.01
Chow UTSW 2 146,188,638 (GRCm39) nonsense probably null
purina UTSW 2 146,175,406 (GRCm39) missense probably damaging 1.00
P4748:Ralgapa2 UTSW 2 146,188,731 (GRCm39) nonsense probably null
R0012:Ralgapa2 UTSW 2 146,254,672 (GRCm39) missense probably benign
R0012:Ralgapa2 UTSW 2 146,254,672 (GRCm39) missense probably benign
R0165:Ralgapa2 UTSW 2 146,230,407 (GRCm39) splice site probably benign
R0344:Ralgapa2 UTSW 2 146,188,714 (GRCm39) missense possibly damaging 0.69
R0402:Ralgapa2 UTSW 2 146,276,729 (GRCm39) missense probably damaging 0.98
R0419:Ralgapa2 UTSW 2 146,270,592 (GRCm39) missense possibly damaging 0.69
R0638:Ralgapa2 UTSW 2 146,184,112 (GRCm39) missense probably benign 0.00
R0704:Ralgapa2 UTSW 2 146,293,704 (GRCm39) missense probably damaging 1.00
R0722:Ralgapa2 UTSW 2 146,230,451 (GRCm39) missense probably damaging 1.00
R0866:Ralgapa2 UTSW 2 146,277,923 (GRCm39) missense probably damaging 1.00
R1065:Ralgapa2 UTSW 2 146,292,478 (GRCm39) missense probably benign 0.00
R1212:Ralgapa2 UTSW 2 146,199,902 (GRCm39) missense probably benign 0.00
R1395:Ralgapa2 UTSW 2 146,230,420 (GRCm39) missense probably damaging 1.00
R1614:Ralgapa2 UTSW 2 146,230,532 (GRCm39) missense probably damaging 1.00
R1686:Ralgapa2 UTSW 2 146,199,920 (GRCm39) missense probably benign 0.09
R1799:Ralgapa2 UTSW 2 146,184,648 (GRCm39) missense probably benign 0.02
R1905:Ralgapa2 UTSW 2 146,229,621 (GRCm39) missense probably damaging 1.00
R1956:Ralgapa2 UTSW 2 146,302,679 (GRCm39) missense probably benign 0.00
R2144:Ralgapa2 UTSW 2 146,230,524 (GRCm39) missense probably damaging 1.00
R2148:Ralgapa2 UTSW 2 146,273,807 (GRCm39) missense probably benign 0.02
R2219:Ralgapa2 UTSW 2 146,263,599 (GRCm39) missense probably benign 0.09
R2220:Ralgapa2 UTSW 2 146,263,599 (GRCm39) missense probably benign 0.09
R2261:Ralgapa2 UTSW 2 146,184,603 (GRCm39) missense probably damaging 1.00
R2402:Ralgapa2 UTSW 2 146,195,112 (GRCm39) missense probably damaging 1.00
R2495:Ralgapa2 UTSW 2 146,203,320 (GRCm39) missense possibly damaging 0.82
R3752:Ralgapa2 UTSW 2 146,263,551 (GRCm39) missense possibly damaging 0.94
R3953:Ralgapa2 UTSW 2 146,277,884 (GRCm39) missense probably damaging 1.00
R3956:Ralgapa2 UTSW 2 146,277,884 (GRCm39) missense probably damaging 1.00
R4177:Ralgapa2 UTSW 2 146,327,083 (GRCm39) missense probably damaging 1.00
R4182:Ralgapa2 UTSW 2 146,277,914 (GRCm39) missense probably damaging 1.00
R4193:Ralgapa2 UTSW 2 146,184,493 (GRCm39) missense probably damaging 1.00
R4332:Ralgapa2 UTSW 2 146,102,288 (GRCm39) missense probably benign 0.10
R4507:Ralgapa2 UTSW 2 146,195,168 (GRCm39) missense probably benign 0.11
R4574:Ralgapa2 UTSW 2 146,277,919 (GRCm39) missense probably damaging 1.00
R4585:Ralgapa2 UTSW 2 146,156,944 (GRCm39) missense probably damaging 0.99
R4627:Ralgapa2 UTSW 2 146,203,373 (GRCm39) missense possibly damaging 0.88
R4647:Ralgapa2 UTSW 2 146,229,549 (GRCm39) missense possibly damaging 0.69
R4677:Ralgapa2 UTSW 2 146,187,387 (GRCm39) missense possibly damaging 0.82
R4724:Ralgapa2 UTSW 2 146,187,453 (GRCm39) missense possibly damaging 0.46
R4760:Ralgapa2 UTSW 2 146,188,669 (GRCm39) missense probably benign 0.00
R4831:Ralgapa2 UTSW 2 146,246,987 (GRCm39) intron probably benign
R4962:Ralgapa2 UTSW 2 146,276,754 (GRCm39) nonsense probably null
R4993:Ralgapa2 UTSW 2 146,289,231 (GRCm39) missense probably damaging 1.00
R5041:Ralgapa2 UTSW 2 146,327,071 (GRCm39) missense probably benign 0.00
R5120:Ralgapa2 UTSW 2 146,254,004 (GRCm39) missense probably benign 0.26
R5185:Ralgapa2 UTSW 2 146,230,406 (GRCm39) splice site probably null
R5393:Ralgapa2 UTSW 2 146,187,375 (GRCm39) missense probably damaging 1.00
R5428:Ralgapa2 UTSW 2 146,176,414 (GRCm39) missense probably damaging 0.96
R5439:Ralgapa2 UTSW 2 146,184,430 (GRCm39) missense probably benign 0.08
R5476:Ralgapa2 UTSW 2 146,289,356 (GRCm39) missense probably benign
R5695:Ralgapa2 UTSW 2 146,175,397 (GRCm39) missense probably damaging 1.00
R5705:Ralgapa2 UTSW 2 146,291,193 (GRCm39) missense probably damaging 1.00
R5718:Ralgapa2 UTSW 2 146,295,326 (GRCm39) splice site probably null
R5817:Ralgapa2 UTSW 2 146,175,406 (GRCm39) missense probably damaging 1.00
R5877:Ralgapa2 UTSW 2 146,230,489 (GRCm39) missense probably damaging 1.00
R6048:Ralgapa2 UTSW 2 146,276,765 (GRCm39) missense possibly damaging 0.46
R6158:Ralgapa2 UTSW 2 146,266,596 (GRCm39) missense possibly damaging 0.69
R6169:Ralgapa2 UTSW 2 146,292,385 (GRCm39) missense probably damaging 1.00
R6280:Ralgapa2 UTSW 2 146,184,129 (GRCm39) missense probably damaging 1.00
R6301:Ralgapa2 UTSW 2 146,169,331 (GRCm39) missense possibly damaging 0.94
R6650:Ralgapa2 UTSW 2 146,230,422 (GRCm39) missense probably damaging 1.00
R6959:Ralgapa2 UTSW 2 146,184,621 (GRCm39) missense probably damaging 0.98
R7020:Ralgapa2 UTSW 2 146,188,638 (GRCm39) nonsense probably null
R7035:Ralgapa2 UTSW 2 146,353,777 (GRCm39) missense probably damaging 1.00
R7167:Ralgapa2 UTSW 2 146,190,374 (GRCm39) missense probably benign
R7186:Ralgapa2 UTSW 2 146,230,406 (GRCm39) splice site probably null
R7252:Ralgapa2 UTSW 2 146,184,671 (GRCm39) critical splice acceptor site probably null
R7266:Ralgapa2 UTSW 2 146,176,488 (GRCm39) missense probably damaging 1.00
R7371:Ralgapa2 UTSW 2 146,189,046 (GRCm39) missense probably benign 0.05
R7432:Ralgapa2 UTSW 2 146,276,776 (GRCm39) missense probably benign 0.41
R7470:Ralgapa2 UTSW 2 146,266,587 (GRCm39) missense probably damaging 1.00
R7663:Ralgapa2 UTSW 2 146,260,335 (GRCm39) missense probably benign 0.01
R7780:Ralgapa2 UTSW 2 146,184,334 (GRCm39) missense probably benign 0.14
R7973:Ralgapa2 UTSW 2 146,230,481 (GRCm39) missense possibly damaging 0.88
R8018:Ralgapa2 UTSW 2 146,182,311 (GRCm39) missense probably damaging 1.00
R8063:Ralgapa2 UTSW 2 146,285,775 (GRCm39) missense probably damaging 1.00
R8070:Ralgapa2 UTSW 2 146,195,199 (GRCm39) missense probably damaging 0.98
R8264:Ralgapa2 UTSW 2 146,175,370 (GRCm39) missense possibly damaging 0.90
R8309:Ralgapa2 UTSW 2 146,246,786 (GRCm39) missense possibly damaging 0.66
R8409:Ralgapa2 UTSW 2 146,086,897 (GRCm39) missense
R8474:Ralgapa2 UTSW 2 146,266,750 (GRCm39) missense probably damaging 1.00
R8487:Ralgapa2 UTSW 2 146,230,463 (GRCm39) missense probably damaging 1.00
R8492:Ralgapa2 UTSW 2 146,184,524 (GRCm39) missense possibly damaging 0.50
R8733:Ralgapa2 UTSW 2 146,266,683 (GRCm39) missense probably damaging 1.00
R8856:Ralgapa2 UTSW 2 146,184,139 (GRCm39) missense probably benign 0.30
R8858:Ralgapa2 UTSW 2 146,102,285 (GRCm39) critical splice donor site probably null
R8862:Ralgapa2 UTSW 2 146,266,731 (GRCm39) missense probably benign 0.41
R9146:Ralgapa2 UTSW 2 146,184,252 (GRCm39) missense probably benign
R9324:Ralgapa2 UTSW 2 146,302,645 (GRCm39) missense probably damaging 1.00
R9439:Ralgapa2 UTSW 2 146,254,058 (GRCm39) missense probably benign
R9457:Ralgapa2 UTSW 2 146,176,474 (GRCm39) missense probably damaging 0.99
RF019:Ralgapa2 UTSW 2 146,203,423 (GRCm39) missense possibly damaging 0.53
X0019:Ralgapa2 UTSW 2 146,230,572 (GRCm39) missense possibly damaging 0.56
Z1088:Ralgapa2 UTSW 2 146,276,825 (GRCm39) missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- CCCAGTTTCACATCGCACTAATG -3'
(R):5'- ACCATTGGAATTATGCATCCCC -3'

Sequencing Primer
(F):5'- TGAGTCAACACCTGTTAAGAGTG -3'
(R):5'- GGAATTATGCATCCCCCGTAC -3'
Posted On 2017-06-26