Incidental Mutation 'R5994:Zfp292'
ID 480985
Institutional Source Beutler Lab
Gene Symbol Zfp292
Ensembl Gene ENSMUSG00000039967
Gene Name zinc finger protein 292
Synonyms Zfp-15, 9430062L07Rik, Zn-16, Zfp15, Zn-15, 5730450D02Rik, Krox-10
MMRRC Submission 044173-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.843) question?
Stock # R5994 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 34803113-34882960 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 34805464 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 2527 (V2527M)
Ref Sequence ENSEMBL: ENSMUSP00000095766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047950] [ENSMUST00000098163]
AlphaFold Q9Z2U2
Predicted Effect possibly damaging
Transcript: ENSMUST00000047950
AA Change: V2532M

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037233
Gene: ENSMUSG00000039967
AA Change: V2532M

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
low complexity region 101 120 N/A INTRINSIC
low complexity region 512 523 N/A INTRINSIC
ZnF_C2H2 540 561 5.12e1 SMART
ZnF_C2H2 567 589 4.72e-2 SMART
low complexity region 649 664 N/A INTRINSIC
ZnF_C2H2 681 705 3.52e-1 SMART
ZnF_C2H2 722 744 1.53e-1 SMART
ZnF_C2H2 750 774 1.62e0 SMART
ZnF_C2H2 779 803 1.08e1 SMART
ZnF_C2H2 807 831 1.95e-3 SMART
low complexity region 1062 1078 N/A INTRINSIC
ZnF_C2H2 1085 1110 7.67e-2 SMART
ZnF_C2H2 1361 1381 1.93e2 SMART
low complexity region 1606 1618 N/A INTRINSIC
ZnF_C2H2 1879 1904 4.4e-2 SMART
ZnF_C2H2 1924 1949 5.42e-2 SMART
low complexity region 2004 2014 N/A INTRINSIC
low complexity region 2024 2037 N/A INTRINSIC
coiled coil region 2050 2072 N/A INTRINSIC
ZnF_C2H2 2091 2116 4.45e0 SMART
low complexity region 2121 2143 N/A INTRINSIC
ZnF_C2H2 2149 2174 1.64e-1 SMART
ZnF_C2H2 2193 2218 3.24e0 SMART
ZnF_C2H2 2233 2258 1.18e-2 SMART
low complexity region 2301 2314 N/A INTRINSIC
ZnF_C2H2 2362 2386 2.86e-1 SMART
low complexity region 2589 2605 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000098163
AA Change: V2527M

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095766
Gene: ENSMUSG00000039967
AA Change: V2527M

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
low complexity region 101 120 N/A INTRINSIC
low complexity region 507 518 N/A INTRINSIC
ZnF_C2H2 535 556 5.12e1 SMART
ZnF_C2H2 562 584 4.72e-2 SMART
low complexity region 644 659 N/A INTRINSIC
ZnF_C2H2 676 700 3.52e-1 SMART
ZnF_C2H2 717 739 1.53e-1 SMART
ZnF_C2H2 745 769 1.62e0 SMART
ZnF_C2H2 774 798 1.08e1 SMART
ZnF_C2H2 802 826 1.95e-3 SMART
low complexity region 1057 1073 N/A INTRINSIC
ZnF_C2H2 1080 1105 7.67e-2 SMART
ZnF_C2H2 1356 1376 1.93e2 SMART
low complexity region 1601 1613 N/A INTRINSIC
ZnF_C2H2 1874 1899 4.4e-2 SMART
ZnF_C2H2 1919 1944 5.42e-2 SMART
low complexity region 1999 2009 N/A INTRINSIC
low complexity region 2019 2032 N/A INTRINSIC
coiled coil region 2045 2067 N/A INTRINSIC
ZnF_C2H2 2086 2111 4.45e0 SMART
low complexity region 2116 2138 N/A INTRINSIC
ZnF_C2H2 2144 2169 1.64e-1 SMART
ZnF_C2H2 2188 2213 3.24e0 SMART
ZnF_C2H2 2228 2253 1.18e-2 SMART
low complexity region 2296 2309 N/A INTRINSIC
ZnF_C2H2 2357 2381 2.86e-1 SMART
low complexity region 2584 2600 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,647,862 (GRCm39) H1118L probably benign Het
Abca8b A G 11: 109,840,592 (GRCm39) probably null Het
Abcb5 A T 12: 118,928,995 (GRCm39) probably null Het
Adcy6 A T 15: 98,491,545 (GRCm39) I1016N probably damaging Het
Afg3l2 A T 18: 67,562,140 (GRCm39) C312S probably damaging Het
Ano8 C T 8: 71,937,478 (GRCm39) V89M probably damaging Het
Arhgap21 C T 2: 20,886,187 (GRCm39) G330D possibly damaging Het
Caskin1 T C 17: 24,715,935 (GRCm39) L195P probably damaging Het
Cfap54 A G 10: 92,874,943 (GRCm39) I514T probably damaging Het
Ctdsp2 G A 10: 126,831,689 (GRCm39) probably benign Het
Cyp4x1 T C 4: 114,979,142 (GRCm39) I152V probably benign Het
Dglucy G A 12: 100,808,959 (GRCm39) R219Q probably benign Het
Disp3 G T 4: 148,338,741 (GRCm39) A810E possibly damaging Het
Dtx4 T C 19: 12,478,517 (GRCm39) Y22C probably damaging Het
Edaradd A T 13: 12,493,377 (GRCm39) I105N probably damaging Het
Eepd1 C T 9: 25,514,749 (GRCm39) P519S probably damaging Het
Fscn3 A T 6: 28,430,294 (GRCm39) S155C probably benign Het
Gm10134 A T 2: 28,396,258 (GRCm39) E51V probably damaging Het
Gm7247 C T 14: 51,601,805 (GRCm39) S26F probably benign Het
Golga7 T C 8: 23,740,281 (GRCm39) E83G probably benign Het
Gpr12 T C 5: 146,520,241 (GRCm39) H227R probably damaging Het
Hoxa2 T G 6: 52,141,372 (GRCm39) S85R possibly damaging Het
Hrnr T C 3: 93,239,607 (GRCm39) S3282P unknown Het
Ift74 C A 4: 94,579,961 (GRCm39) T543K possibly damaging Het
Klf10 C A 15: 38,296,285 (GRCm39) R420L probably damaging Het
Krt77 T A 15: 101,771,290 (GRCm39) I338F probably damaging Het
Limch1 A T 5: 67,131,965 (GRCm39) S152C probably damaging Het
Mgat4e T A 1: 134,469,234 (GRCm39) H270L probably benign Het
Myrf A T 19: 10,196,481 (GRCm39) L504Q probably null Het
Nckipsd A G 9: 108,691,176 (GRCm39) Q366R probably benign Het
Npy5r A T 8: 67,134,751 (GRCm39) V14D probably benign Het
Nrap T A 19: 56,340,031 (GRCm39) R830* probably null Het
Ogfrl1 A T 1: 23,418,070 (GRCm39) Y103N probably damaging Het
Or10g7 A T 9: 39,905,519 (GRCm39) R138* probably null Het
P2rx4 T A 5: 122,863,142 (GRCm39) L232H probably damaging Het
Pabpc2 A T 18: 39,906,947 (GRCm39) T71S probably benign Het
Paip2b C A 6: 83,785,867 (GRCm39) S121I probably damaging Het
Pofut1 C T 2: 153,103,149 (GRCm39) T261I possibly damaging Het
Ppp6c G T 2: 39,101,004 (GRCm39) T46K possibly damaging Het
Prkd2 C A 7: 16,584,261 (GRCm39) H371Q probably benign Het
Prrc2c A T 1: 162,501,725 (GRCm39) probably null Het
Psd3 C T 8: 68,172,620 (GRCm39) A894T probably damaging Het
Pygm A T 19: 6,448,073 (GRCm39) probably null Het
Pzp A T 6: 128,468,560 (GRCm39) M989K probably damaging Het
Ralgapa2 A T 2: 146,203,373 (GRCm39) S1159T probably benign Het
Rapgefl1 T C 11: 98,740,986 (GRCm39) F575L probably benign Het
Rassf6 A G 5: 90,765,627 (GRCm39) L28S probably damaging Het
Rbp3 G T 14: 33,676,857 (GRCm39) K268N probably damaging Het
Rela C T 19: 5,697,092 (GRCm39) T433M possibly damaging Het
Rnf103 T A 6: 71,473,894 (GRCm39) S102R probably damaging Het
Scarf2 A G 16: 17,624,243 (GRCm39) N516S probably damaging Het
Sdcbp2 T C 2: 151,429,403 (GRCm39) I241T probably damaging Het
Septin7 T C 9: 25,199,494 (GRCm39) I131T possibly damaging Het
Sh3pxd2b T C 11: 32,357,570 (GRCm39) F191L probably damaging Het
Siglec15 C A 18: 78,090,590 (GRCm39) C236F probably damaging Het
Slc11a2 T C 15: 100,295,562 (GRCm39) T520A probably benign Het
Slc26a11 C A 11: 119,270,738 (GRCm39) F553L probably benign Het
Smchd1 G A 17: 71,672,404 (GRCm39) P1596S possibly damaging Het
Taar7b A G 10: 23,876,246 (GRCm39) H137R probably damaging Het
Thap12 T A 7: 98,365,237 (GRCm39) C468* probably null Het
Timp4 C T 6: 115,224,315 (GRCm39) G118D probably damaging Het
Tnnt3 A G 7: 142,065,003 (GRCm39) K48E probably damaging Het
Trmt10a T A 3: 137,862,475 (GRCm39) I255N probably damaging Het
Ttll10 T C 4: 156,133,189 (GRCm39) probably null Het
Tut7 T G 13: 59,937,023 (GRCm39) Y806S probably damaging Het
Ube4b A G 4: 149,457,389 (GRCm39) Y283H probably damaging Het
Ucp1 G T 8: 84,020,567 (GRCm39) V126L possibly damaging Het
Unc13b T A 4: 43,172,596 (GRCm39) probably benign Het
Vps13b T C 15: 35,875,918 (GRCm39) S2768P probably damaging Het
Zfp101 T A 17: 33,599,936 (GRCm39) M607L probably benign Het
Zfp503 T A 14: 22,035,630 (GRCm39) T429S possibly damaging Het
Other mutations in Zfp292
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Zfp292 APN 4 34,808,683 (GRCm39) missense probably benign 0.15
IGL00502:Zfp292 APN 4 34,809,775 (GRCm39) missense possibly damaging 0.63
IGL00539:Zfp292 APN 4 34,808,790 (GRCm39) missense probably damaging 0.98
IGL00676:Zfp292 APN 4 34,807,827 (GRCm39) missense probably damaging 0.99
IGL01068:Zfp292 APN 4 34,806,763 (GRCm39) missense probably damaging 1.00
IGL01311:Zfp292 APN 4 34,807,961 (GRCm39) missense probably benign 0.01
IGL01639:Zfp292 APN 4 34,809,048 (GRCm39) missense probably benign 0.04
IGL01688:Zfp292 APN 4 34,807,855 (GRCm39) missense possibly damaging 0.93
IGL02345:Zfp292 APN 4 34,809,244 (GRCm39) missense possibly damaging 0.94
IGL02444:Zfp292 APN 4 34,808,810 (GRCm39) missense possibly damaging 0.87
IGL02548:Zfp292 APN 4 34,805,416 (GRCm39) missense probably damaging 1.00
IGL02551:Zfp292 APN 4 34,806,462 (GRCm39) missense possibly damaging 0.93
IGL02702:Zfp292 APN 4 34,809,415 (GRCm39) missense probably benign 0.14
IGL02715:Zfp292 APN 4 34,819,542 (GRCm39) missense probably damaging 1.00
IGL03273:Zfp292 APN 4 34,806,163 (GRCm39) missense probably benign 0.00
F5770:Zfp292 UTSW 4 34,806,783 (GRCm39) missense possibly damaging 0.85
PIT4362001:Zfp292 UTSW 4 34,807,524 (GRCm39) missense probably benign 0.00
R0153:Zfp292 UTSW 4 34,811,185 (GRCm39) missense probably benign 0.26
R0184:Zfp292 UTSW 4 34,819,563 (GRCm39) missense probably damaging 1.00
R0295:Zfp292 UTSW 4 34,806,281 (GRCm39) missense probably damaging 1.00
R0367:Zfp292 UTSW 4 34,808,227 (GRCm39) missense probably benign 0.25
R0433:Zfp292 UTSW 4 34,839,959 (GRCm39) missense probably damaging 0.99
R0481:Zfp292 UTSW 4 34,810,059 (GRCm39) missense probably benign 0.28
R0555:Zfp292 UTSW 4 34,807,194 (GRCm39) missense probably damaging 1.00
R0597:Zfp292 UTSW 4 34,807,399 (GRCm39) missense probably benign 0.02
R0748:Zfp292 UTSW 4 34,816,424 (GRCm39) splice site probably benign
R0782:Zfp292 UTSW 4 34,839,382 (GRCm39) missense possibly damaging 0.94
R0834:Zfp292 UTSW 4 34,809,114 (GRCm39) missense probably benign 0.00
R0879:Zfp292 UTSW 4 34,811,218 (GRCm39) missense probably benign 0.00
R1083:Zfp292 UTSW 4 34,807,569 (GRCm39) missense probably damaging 0.98
R1343:Zfp292 UTSW 4 34,805,238 (GRCm39) missense probably damaging 0.98
R1498:Zfp292 UTSW 4 34,805,397 (GRCm39) missense possibly damaging 0.88
R1714:Zfp292 UTSW 4 34,808,935 (GRCm39) missense probably damaging 1.00
R1724:Zfp292 UTSW 4 34,811,237 (GRCm39) missense probably damaging 1.00
R1755:Zfp292 UTSW 4 34,811,043 (GRCm39) missense probably benign 0.02
R1837:Zfp292 UTSW 4 34,810,264 (GRCm39) missense probably damaging 0.98
R1914:Zfp292 UTSW 4 34,805,100 (GRCm39) missense possibly damaging 0.92
R1915:Zfp292 UTSW 4 34,805,100 (GRCm39) missense possibly damaging 0.92
R1936:Zfp292 UTSW 4 34,807,452 (GRCm39) missense probably benign 0.22
R2107:Zfp292 UTSW 4 34,808,593 (GRCm39) missense possibly damaging 0.86
R2108:Zfp292 UTSW 4 34,808,593 (GRCm39) missense possibly damaging 0.86
R2136:Zfp292 UTSW 4 34,810,266 (GRCm39) missense probably benign 0.13
R2182:Zfp292 UTSW 4 34,807,417 (GRCm39) missense probably damaging 1.00
R2186:Zfp292 UTSW 4 34,807,962 (GRCm39) missense probably benign 0.07
R2306:Zfp292 UTSW 4 34,809,468 (GRCm39) missense probably damaging 0.96
R2350:Zfp292 UTSW 4 34,811,281 (GRCm39) missense probably damaging 1.00
R2382:Zfp292 UTSW 4 34,806,426 (GRCm39) missense possibly damaging 0.91
R2872:Zfp292 UTSW 4 34,808,595 (GRCm39) missense probably damaging 1.00
R2872:Zfp292 UTSW 4 34,808,595 (GRCm39) missense probably damaging 1.00
R3018:Zfp292 UTSW 4 34,808,814 (GRCm39) missense probably damaging 0.99
R3812:Zfp292 UTSW 4 34,810,326 (GRCm39) missense probably damaging 0.98
R4006:Zfp292 UTSW 4 34,807,744 (GRCm39) missense probably benign 0.00
R4006:Zfp292 UTSW 4 34,809,611 (GRCm39) missense possibly damaging 0.62
R4060:Zfp292 UTSW 4 34,810,863 (GRCm39) missense probably damaging 1.00
R4062:Zfp292 UTSW 4 34,810,863 (GRCm39) missense probably damaging 1.00
R4063:Zfp292 UTSW 4 34,810,863 (GRCm39) missense probably damaging 1.00
R4064:Zfp292 UTSW 4 34,810,863 (GRCm39) missense probably damaging 1.00
R4207:Zfp292 UTSW 4 34,806,079 (GRCm39) missense probably benign 0.04
R4641:Zfp292 UTSW 4 34,807,828 (GRCm39) missense probably damaging 0.99
R4684:Zfp292 UTSW 4 34,807,078 (GRCm39) missense probably benign 0.00
R4718:Zfp292 UTSW 4 34,819,521 (GRCm39) missense possibly damaging 0.92
R4865:Zfp292 UTSW 4 34,819,563 (GRCm39) missense probably damaging 1.00
R4870:Zfp292 UTSW 4 34,808,917 (GRCm39) missense probably damaging 1.00
R5097:Zfp292 UTSW 4 34,839,878 (GRCm39) missense possibly damaging 0.89
R5233:Zfp292 UTSW 4 34,809,755 (GRCm39) missense probably damaging 1.00
R5246:Zfp292 UTSW 4 34,805,842 (GRCm39) missense possibly damaging 0.76
R5369:Zfp292 UTSW 4 34,807,491 (GRCm39) missense possibly damaging 0.89
R5527:Zfp292 UTSW 4 34,806,261 (GRCm39) missense probably damaging 1.00
R5621:Zfp292 UTSW 4 34,811,703 (GRCm39) missense probably damaging 0.98
R5770:Zfp292 UTSW 4 34,806,747 (GRCm39) missense probably damaging 1.00
R5900:Zfp292 UTSW 4 34,805,125 (GRCm39) missense probably damaging 1.00
R5905:Zfp292 UTSW 4 34,819,549 (GRCm39) missense probably damaging 1.00
R6028:Zfp292 UTSW 4 34,819,549 (GRCm39) missense probably damaging 1.00
R6056:Zfp292 UTSW 4 34,809,784 (GRCm39) missense probably damaging 1.00
R6093:Zfp292 UTSW 4 34,811,902 (GRCm39) missense probably damaging 1.00
R6126:Zfp292 UTSW 4 34,808,497 (GRCm39) missense probably benign 0.13
R6209:Zfp292 UTSW 4 34,809,442 (GRCm39) missense probably benign 0.14
R6275:Zfp292 UTSW 4 34,808,883 (GRCm39) missense possibly damaging 0.93
R6523:Zfp292 UTSW 4 34,816,301 (GRCm39) missense probably benign 0.21
R6747:Zfp292 UTSW 4 34,806,894 (GRCm39) missense probably damaging 0.97
R6752:Zfp292 UTSW 4 34,808,593 (GRCm39) missense possibly damaging 0.86
R6967:Zfp292 UTSW 4 34,807,812 (GRCm39) missense probably damaging 1.00
R7038:Zfp292 UTSW 4 34,816,357 (GRCm39) missense probably damaging 1.00
R7056:Zfp292 UTSW 4 34,809,784 (GRCm39) missense probably damaging 1.00
R7088:Zfp292 UTSW 4 34,806,796 (GRCm39) missense probably damaging 1.00
R7158:Zfp292 UTSW 4 34,808,679 (GRCm39) missense probably benign
R7254:Zfp292 UTSW 4 34,819,476 (GRCm39) missense probably damaging 0.98
R7350:Zfp292 UTSW 4 34,806,839 (GRCm39) missense probably benign
R7378:Zfp292 UTSW 4 34,808,384 (GRCm39) missense probably benign 0.26
R7535:Zfp292 UTSW 4 34,811,487 (GRCm39) missense probably benign 0.28
R7589:Zfp292 UTSW 4 34,806,777 (GRCm39) missense probably damaging 1.00
R7816:Zfp292 UTSW 4 34,809,865 (GRCm39) missense probably benign 0.02
R7979:Zfp292 UTSW 4 34,809,198 (GRCm39) missense probably benign 0.02
R7997:Zfp292 UTSW 4 34,808,688 (GRCm39) missense probably damaging 0.96
R8129:Zfp292 UTSW 4 34,807,386 (GRCm39) missense probably damaging 1.00
R8211:Zfp292 UTSW 4 34,806,163 (GRCm39) missense probably benign 0.00
R8302:Zfp292 UTSW 4 34,810,893 (GRCm39) missense possibly damaging 0.64
R8500:Zfp292 UTSW 4 34,826,691 (GRCm39) critical splice donor site probably null
R8709:Zfp292 UTSW 4 34,805,982 (GRCm39) missense probably damaging 1.00
R8947:Zfp292 UTSW 4 34,811,835 (GRCm39) missense probably damaging 1.00
R9099:Zfp292 UTSW 4 34,809,228 (GRCm39) missense possibly damaging 0.53
R9190:Zfp292 UTSW 4 34,819,563 (GRCm39) missense probably damaging 1.00
R9256:Zfp292 UTSW 4 34,839,899 (GRCm39) missense probably benign 0.02
R9371:Zfp292 UTSW 4 34,810,800 (GRCm39) missense probably damaging 1.00
R9492:Zfp292 UTSW 4 34,810,794 (GRCm39) missense probably benign 0.12
R9574:Zfp292 UTSW 4 34,839,460 (GRCm39) missense probably damaging 1.00
V7580:Zfp292 UTSW 4 34,806,783 (GRCm39) missense possibly damaging 0.85
V7581:Zfp292 UTSW 4 34,806,783 (GRCm39) missense possibly damaging 0.85
V7582:Zfp292 UTSW 4 34,806,783 (GRCm39) missense possibly damaging 0.85
V7583:Zfp292 UTSW 4 34,806,783 (GRCm39) missense possibly damaging 0.85
Z1177:Zfp292 UTSW 4 34,811,058 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTGTTTGAATGGTCTCTGTCAC -3'
(R):5'- TGCTGCTCCACAGGAAGAAG -3'

Sequencing Primer
(F):5'- TGAATGGTCTCTGTCACTATTTTTC -3'
(R):5'- TGCTCCACAGGAAGAAGGTAGAAAAG -3'
Posted On 2017-06-26