Incidental Mutation 'R5994:Unc13b'
ID 480986
Institutional Source Beutler Lab
Gene Symbol Unc13b
Ensembl Gene ENSMUSG00000028456
Gene Name unc-13 homolog B
Synonyms Munc13-2, Unc13h2
MMRRC Submission 044173-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.262) question?
Stock # R5994 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 43058953-43264871 bp(+) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) T to A at 43172596 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128608 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079978] [ENSMUST00000107952] [ENSMUST00000107953] [ENSMUST00000163653] [ENSMUST00000207569]
AlphaFold Q9Z1N9
Predicted Effect probably benign
Transcript: ENSMUST00000079978
SMART Domains Protein: ENSMUSP00000078894
Gene: ENSMUSG00000028456

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 179 193 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 322 333 N/A INTRINSIC
C1 478 527 4.21e-18 SMART
C2 601 708 2.07e-22 SMART
DUF1041 917 1021 2.02e-53 SMART
Pfam:Membr_traf_MHD 1262 1404 4.8e-60 PFAM
C2 1438 1544 7.56e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107952
SMART Domains Protein: ENSMUSP00000103586
Gene: ENSMUSG00000028456

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 191 205 N/A INTRINSIC
low complexity region 304 315 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
C1 490 539 4.21e-18 SMART
C2 613 720 2.07e-22 SMART
DUF1041 929 1033 2.02e-53 SMART
Pfam:Membr_traf_MHD 1274 1416 4.8e-60 PFAM
C2 1450 1556 7.56e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107953
SMART Domains Protein: ENSMUSP00000103587
Gene: ENSMUSG00000028456

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 179 193 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 322 333 N/A INTRINSIC
C1 478 527 4.21e-18 SMART
C2 601 708 2.07e-22 SMART
DUF1041 917 1021 2.02e-53 SMART
Pfam:Membr_traf_MHD 1263 1403 2.3e-56 PFAM
C2 1457 1563 7.56e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132310
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151611
Predicted Effect probably benign
Transcript: ENSMUST00000163653
SMART Domains Protein: ENSMUSP00000128608
Gene: ENSMUSG00000028456

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 191 205 N/A INTRINSIC
low complexity region 304 315 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
C1 490 539 4.21e-18 SMART
C2 613 720 2.07e-22 SMART
DUF1041 929 1032 4.64e-53 SMART
Pfam:Membr_traf_MHD 1273 1415 4.8e-60 PFAM
C2 1449 1555 7.56e-16 SMART
Predicted Effect unknown
Transcript: ENSMUST00000207569
AA Change: D1141E
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171234
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is expressed in the kidney cortical epithelial cells and is upregulated by hyperglycemia. The encoded protein shares a high level of similarity to the rat homolog, and contains 3 C2 domains and a diacylglycerol-binding C1 domain. Hyperglycemia increases the levels of diacylglycerol, which has been shown to induce apoptosis in cells transfected with this gene and thus contribute to the renal cell complications of hyperglycemia. Studies in other species also indicate a role for this protein in the priming step of synaptic vesicle exocytosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are grossly phenotypically normal. Mice older than 12 months will exhibit sporadic seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,647,862 (GRCm39) H1118L probably benign Het
Abca8b A G 11: 109,840,592 (GRCm39) probably null Het
Abcb5 A T 12: 118,928,995 (GRCm39) probably null Het
Adcy6 A T 15: 98,491,545 (GRCm39) I1016N probably damaging Het
Afg3l2 A T 18: 67,562,140 (GRCm39) C312S probably damaging Het
Ano8 C T 8: 71,937,478 (GRCm39) V89M probably damaging Het
Arhgap21 C T 2: 20,886,187 (GRCm39) G330D possibly damaging Het
Caskin1 T C 17: 24,715,935 (GRCm39) L195P probably damaging Het
Cfap54 A G 10: 92,874,943 (GRCm39) I514T probably damaging Het
Ctdsp2 G A 10: 126,831,689 (GRCm39) probably benign Het
Cyp4x1 T C 4: 114,979,142 (GRCm39) I152V probably benign Het
Dglucy G A 12: 100,808,959 (GRCm39) R219Q probably benign Het
Disp3 G T 4: 148,338,741 (GRCm39) A810E possibly damaging Het
Dtx4 T C 19: 12,478,517 (GRCm39) Y22C probably damaging Het
Edaradd A T 13: 12,493,377 (GRCm39) I105N probably damaging Het
Eepd1 C T 9: 25,514,749 (GRCm39) P519S probably damaging Het
Fscn3 A T 6: 28,430,294 (GRCm39) S155C probably benign Het
Gm10134 A T 2: 28,396,258 (GRCm39) E51V probably damaging Het
Gm7247 C T 14: 51,601,805 (GRCm39) S26F probably benign Het
Golga7 T C 8: 23,740,281 (GRCm39) E83G probably benign Het
Gpr12 T C 5: 146,520,241 (GRCm39) H227R probably damaging Het
Hoxa2 T G 6: 52,141,372 (GRCm39) S85R possibly damaging Het
Hrnr T C 3: 93,239,607 (GRCm39) S3282P unknown Het
Ift74 C A 4: 94,579,961 (GRCm39) T543K possibly damaging Het
Klf10 C A 15: 38,296,285 (GRCm39) R420L probably damaging Het
Krt77 T A 15: 101,771,290 (GRCm39) I338F probably damaging Het
Limch1 A T 5: 67,131,965 (GRCm39) S152C probably damaging Het
Mgat4e T A 1: 134,469,234 (GRCm39) H270L probably benign Het
Myrf A T 19: 10,196,481 (GRCm39) L504Q probably null Het
Nckipsd A G 9: 108,691,176 (GRCm39) Q366R probably benign Het
Npy5r A T 8: 67,134,751 (GRCm39) V14D probably benign Het
Nrap T A 19: 56,340,031 (GRCm39) R830* probably null Het
Ogfrl1 A T 1: 23,418,070 (GRCm39) Y103N probably damaging Het
Or10g7 A T 9: 39,905,519 (GRCm39) R138* probably null Het
P2rx4 T A 5: 122,863,142 (GRCm39) L232H probably damaging Het
Pabpc2 A T 18: 39,906,947 (GRCm39) T71S probably benign Het
Paip2b C A 6: 83,785,867 (GRCm39) S121I probably damaging Het
Pofut1 C T 2: 153,103,149 (GRCm39) T261I possibly damaging Het
Ppp6c G T 2: 39,101,004 (GRCm39) T46K possibly damaging Het
Prkd2 C A 7: 16,584,261 (GRCm39) H371Q probably benign Het
Prrc2c A T 1: 162,501,725 (GRCm39) probably null Het
Psd3 C T 8: 68,172,620 (GRCm39) A894T probably damaging Het
Pygm A T 19: 6,448,073 (GRCm39) probably null Het
Pzp A T 6: 128,468,560 (GRCm39) M989K probably damaging Het
Ralgapa2 A T 2: 146,203,373 (GRCm39) S1159T probably benign Het
Rapgefl1 T C 11: 98,740,986 (GRCm39) F575L probably benign Het
Rassf6 A G 5: 90,765,627 (GRCm39) L28S probably damaging Het
Rbp3 G T 14: 33,676,857 (GRCm39) K268N probably damaging Het
Rela C T 19: 5,697,092 (GRCm39) T433M possibly damaging Het
Rnf103 T A 6: 71,473,894 (GRCm39) S102R probably damaging Het
Scarf2 A G 16: 17,624,243 (GRCm39) N516S probably damaging Het
Sdcbp2 T C 2: 151,429,403 (GRCm39) I241T probably damaging Het
Septin7 T C 9: 25,199,494 (GRCm39) I131T possibly damaging Het
Sh3pxd2b T C 11: 32,357,570 (GRCm39) F191L probably damaging Het
Siglec15 C A 18: 78,090,590 (GRCm39) C236F probably damaging Het
Slc11a2 T C 15: 100,295,562 (GRCm39) T520A probably benign Het
Slc26a11 C A 11: 119,270,738 (GRCm39) F553L probably benign Het
Smchd1 G A 17: 71,672,404 (GRCm39) P1596S possibly damaging Het
Taar7b A G 10: 23,876,246 (GRCm39) H137R probably damaging Het
Thap12 T A 7: 98,365,237 (GRCm39) C468* probably null Het
Timp4 C T 6: 115,224,315 (GRCm39) G118D probably damaging Het
Tnnt3 A G 7: 142,065,003 (GRCm39) K48E probably damaging Het
Trmt10a T A 3: 137,862,475 (GRCm39) I255N probably damaging Het
Ttll10 T C 4: 156,133,189 (GRCm39) probably null Het
Tut7 T G 13: 59,937,023 (GRCm39) Y806S probably damaging Het
Ube4b A G 4: 149,457,389 (GRCm39) Y283H probably damaging Het
Ucp1 G T 8: 84,020,567 (GRCm39) V126L possibly damaging Het
Vps13b T C 15: 35,875,918 (GRCm39) S2768P probably damaging Het
Zfp101 T A 17: 33,599,936 (GRCm39) M607L probably benign Het
Zfp292 C T 4: 34,805,464 (GRCm39) V2527M possibly damaging Het
Zfp503 T A 14: 22,035,630 (GRCm39) T429S possibly damaging Het
Other mutations in Unc13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Unc13b APN 4 43,240,285 (GRCm39) missense probably damaging 1.00
IGL00832:Unc13b APN 4 43,258,921 (GRCm39) missense probably damaging 1.00
IGL01111:Unc13b APN 4 43,096,927 (GRCm39) missense possibly damaging 0.76
IGL01115:Unc13b APN 4 43,258,492 (GRCm39) missense probably damaging 1.00
IGL01137:Unc13b APN 4 43,091,291 (GRCm39) missense probably damaging 1.00
IGL01637:Unc13b APN 4 43,241,066 (GRCm39) missense probably damaging 1.00
IGL01789:Unc13b APN 4 43,239,462 (GRCm39) missense probably damaging 1.00
IGL01792:Unc13b APN 4 43,250,218 (GRCm39) missense probably damaging 0.99
IGL01877:Unc13b APN 4 43,249,583 (GRCm39) critical splice donor site probably null
IGL01924:Unc13b APN 4 43,239,385 (GRCm39) nonsense probably null
IGL02087:Unc13b APN 4 43,091,270 (GRCm39) missense probably null 1.00
IGL02197:Unc13b APN 4 43,165,828 (GRCm39) missense probably damaging 0.99
IGL02504:Unc13b APN 4 43,263,031 (GRCm39) missense probably damaging 1.00
IGL02659:Unc13b APN 4 43,235,332 (GRCm39) missense probably damaging 1.00
IGL03031:Unc13b APN 4 43,235,368 (GRCm39) missense probably damaging 1.00
IGL03036:Unc13b APN 4 43,235,249 (GRCm39) missense probably damaging 1.00
IGL03209:Unc13b APN 4 43,239,351 (GRCm39) missense probably damaging 0.99
IGL03352:Unc13b APN 4 43,237,110 (GRCm39) missense possibly damaging 0.90
BB006:Unc13b UTSW 4 43,174,399 (GRCm39) missense unknown
BB016:Unc13b UTSW 4 43,174,399 (GRCm39) missense unknown
G1Funyon:Unc13b UTSW 4 43,263,568 (GRCm39) missense probably benign
P0028:Unc13b UTSW 4 43,256,225 (GRCm39) missense probably damaging 1.00
PIT4585001:Unc13b UTSW 4 43,091,298 (GRCm39) missense probably benign 0.03
R0019:Unc13b UTSW 4 43,096,990 (GRCm39) missense possibly damaging 0.58
R0019:Unc13b UTSW 4 43,096,990 (GRCm39) missense possibly damaging 0.58
R0335:Unc13b UTSW 4 43,236,983 (GRCm39) missense possibly damaging 0.95
R0504:Unc13b UTSW 4 43,263,559 (GRCm39) missense probably damaging 0.99
R0631:Unc13b UTSW 4 43,182,849 (GRCm39) missense possibly damaging 0.47
R0748:Unc13b UTSW 4 43,241,164 (GRCm39) splice site probably benign
R1275:Unc13b UTSW 4 43,235,366 (GRCm39) missense probably damaging 1.00
R1293:Unc13b UTSW 4 43,235,190 (GRCm39) missense probably damaging 1.00
R1434:Unc13b UTSW 4 43,239,385 (GRCm39) nonsense probably null
R1552:Unc13b UTSW 4 43,237,144 (GRCm39) missense probably damaging 0.99
R1591:Unc13b UTSW 4 43,244,747 (GRCm39) missense probably damaging 1.00
R1628:Unc13b UTSW 4 43,263,371 (GRCm39) missense probably damaging 1.00
R1740:Unc13b UTSW 4 43,240,285 (GRCm39) missense probably damaging 1.00
R1839:Unc13b UTSW 4 43,258,308 (GRCm39) splice site probably benign
R2045:Unc13b UTSW 4 43,091,266 (GRCm39) missense probably damaging 1.00
R2191:Unc13b UTSW 4 43,245,566 (GRCm39) nonsense probably null
R2259:Unc13b UTSW 4 43,182,780 (GRCm39) missense possibly damaging 0.87
R2307:Unc13b UTSW 4 43,239,854 (GRCm39) missense probably damaging 0.98
R2317:Unc13b UTSW 4 43,245,514 (GRCm39) missense probably damaging 1.00
R2402:Unc13b UTSW 4 43,095,843 (GRCm39) missense probably benign
R2847:Unc13b UTSW 4 43,180,404 (GRCm39) missense probably benign 0.04
R3414:Unc13b UTSW 4 43,234,658 (GRCm39) splice site probably benign
R3436:Unc13b UTSW 4 43,097,028 (GRCm39) splice site probably benign
R3955:Unc13b UTSW 4 43,256,834 (GRCm39) missense probably damaging 1.00
R3957:Unc13b UTSW 4 43,256,834 (GRCm39) missense probably damaging 1.00
R4015:Unc13b UTSW 4 43,237,801 (GRCm39) missense probably damaging 1.00
R4650:Unc13b UTSW 4 43,261,035 (GRCm39) missense probably damaging 0.97
R4836:Unc13b UTSW 4 43,237,137 (GRCm39) missense probably damaging 1.00
R5041:Unc13b UTSW 4 43,237,836 (GRCm39) missense probably benign 0.41
R5413:Unc13b UTSW 4 43,257,936 (GRCm39) critical splice donor site probably null
R6015:Unc13b UTSW 4 43,177,995 (GRCm39) nonsense probably null
R6090:Unc13b UTSW 4 43,239,306 (GRCm39) missense probably damaging 1.00
R6242:Unc13b UTSW 4 43,165,800 (GRCm39) missense possibly damaging 0.92
R6246:Unc13b UTSW 4 43,216,246 (GRCm39) missense probably benign 0.18
R6427:Unc13b UTSW 4 43,176,966 (GRCm39) unclassified probably benign
R6660:Unc13b UTSW 4 43,177,412 (GRCm39) unclassified probably benign
R6670:Unc13b UTSW 4 43,255,562 (GRCm39) missense probably damaging 0.99
R6753:Unc13b UTSW 4 43,239,331 (GRCm39) missense probably damaging 1.00
R6858:Unc13b UTSW 4 43,165,828 (GRCm39) missense possibly damaging 0.85
R6886:Unc13b UTSW 4 43,170,156 (GRCm39) intron probably benign
R6969:Unc13b UTSW 4 43,263,538 (GRCm39) missense possibly damaging 0.94
R6994:Unc13b UTSW 4 43,173,203 (GRCm39) intron probably benign
R6994:Unc13b UTSW 4 43,171,403 (GRCm39) intron probably benign
R7080:Unc13b UTSW 4 43,171,926 (GRCm39) missense unknown
R7117:Unc13b UTSW 4 43,216,544 (GRCm39) missense probably benign 0.33
R7132:Unc13b UTSW 4 43,215,757 (GRCm39) missense probably benign 0.17
R7181:Unc13b UTSW 4 43,258,893 (GRCm39) missense probably damaging 0.99
R7192:Unc13b UTSW 4 43,258,519 (GRCm39) missense probably damaging 1.00
R7246:Unc13b UTSW 4 43,172,910 (GRCm39) missense unknown
R7342:Unc13b UTSW 4 43,258,703 (GRCm39) missense probably damaging 0.99
R7345:Unc13b UTSW 4 43,173,966 (GRCm39) missense unknown
R7355:Unc13b UTSW 4 43,237,754 (GRCm39) missense probably damaging 1.00
R7391:Unc13b UTSW 4 43,216,459 (GRCm39) missense probably benign 0.03
R7419:Unc13b UTSW 4 43,174,023 (GRCm39) missense unknown
R7424:Unc13b UTSW 4 43,172,235 (GRCm39) missense unknown
R7517:Unc13b UTSW 4 43,215,765 (GRCm39) missense probably benign
R7532:Unc13b UTSW 4 43,249,565 (GRCm39) missense probably benign 0.44
R7564:Unc13b UTSW 4 43,091,258 (GRCm39) missense probably damaging 1.00
R7598:Unc13b UTSW 4 43,263,569 (GRCm39) missense probably benign 0.20
R7604:Unc13b UTSW 4 43,256,776 (GRCm39) missense possibly damaging 0.95
R7604:Unc13b UTSW 4 43,170,102 (GRCm39) missense unknown
R7643:Unc13b UTSW 4 43,216,333 (GRCm39) missense probably benign
R7718:Unc13b UTSW 4 43,173,854 (GRCm39) missense unknown
R7735:Unc13b UTSW 4 43,165,791 (GRCm39) missense probably damaging 1.00
R7756:Unc13b UTSW 4 43,177,312 (GRCm39) small deletion probably benign
R7757:Unc13b UTSW 4 43,177,341 (GRCm39) small insertion probably benign
R7757:Unc13b UTSW 4 43,177,330 (GRCm39) small insertion probably benign
R7757:Unc13b UTSW 4 43,177,312 (GRCm39) small deletion probably benign
R7758:Unc13b UTSW 4 43,177,344 (GRCm39) small insertion probably benign
R7758:Unc13b UTSW 4 43,177,312 (GRCm39) small insertion probably benign
R7781:Unc13b UTSW 4 43,259,546 (GRCm39) missense possibly damaging 0.87
R7793:Unc13b UTSW 4 43,172,737 (GRCm39) missense unknown
R7858:Unc13b UTSW 4 43,176,285 (GRCm39) missense unknown
R7867:Unc13b UTSW 4 43,232,573 (GRCm39) nonsense probably null
R7897:Unc13b UTSW 4 43,171,860 (GRCm39) missense unknown
R7904:Unc13b UTSW 4 43,217,075 (GRCm39) missense probably benign
R7929:Unc13b UTSW 4 43,174,399 (GRCm39) missense unknown
R7984:Unc13b UTSW 4 43,173,973 (GRCm39) missense unknown
R8069:Unc13b UTSW 4 43,177,597 (GRCm39) missense unknown
R8101:Unc13b UTSW 4 43,239,918 (GRCm39) missense probably benign 0.08
R8246:Unc13b UTSW 4 43,175,954 (GRCm39) missense unknown
R8289:Unc13b UTSW 4 43,172,524 (GRCm39) nonsense probably null
R8301:Unc13b UTSW 4 43,263,568 (GRCm39) missense probably benign
R8397:Unc13b UTSW 4 43,217,290 (GRCm39) missense probably benign 0.12
R8421:Unc13b UTSW 4 43,178,304 (GRCm39) missense unknown
R8738:Unc13b UTSW 4 43,177,564 (GRCm39) missense unknown
R8746:Unc13b UTSW 4 43,176,120 (GRCm39) missense unknown
R8766:Unc13b UTSW 4 43,174,722 (GRCm39) missense unknown
R8825:Unc13b UTSW 4 43,237,683 (GRCm39) splice site probably benign
R8834:Unc13b UTSW 4 43,175,954 (GRCm39) missense unknown
R8862:Unc13b UTSW 4 43,235,207 (GRCm39) missense probably damaging 1.00
R8864:Unc13b UTSW 4 43,174,724 (GRCm39) missense unknown
R8889:Unc13b UTSW 4 43,176,484 (GRCm39) missense unknown
R8892:Unc13b UTSW 4 43,176,484 (GRCm39) missense unknown
R8904:Unc13b UTSW 4 43,178,531 (GRCm39) intron probably benign
R9089:Unc13b UTSW 4 43,095,847 (GRCm39) missense probably damaging 1.00
R9144:Unc13b UTSW 4 43,173,649 (GRCm39) missense unknown
R9149:Unc13b UTSW 4 43,176,186 (GRCm39) missense unknown
R9173:Unc13b UTSW 4 43,177,421 (GRCm39) missense unknown
R9200:Unc13b UTSW 4 43,257,352 (GRCm39) missense possibly damaging 0.50
R9232:Unc13b UTSW 4 43,240,321 (GRCm39) missense probably benign 0.03
R9269:Unc13b UTSW 4 43,171,955 (GRCm39) missense unknown
R9320:Unc13b UTSW 4 43,171,044 (GRCm39) missense unknown
R9335:Unc13b UTSW 4 43,255,551 (GRCm39) missense probably damaging 0.99
R9335:Unc13b UTSW 4 43,216,123 (GRCm39) missense possibly damaging 0.86
R9352:Unc13b UTSW 4 43,177,313 (GRCm39) nonsense probably null
R9352:Unc13b UTSW 4 43,177,312 (GRCm39) small insertion probably benign
R9378:Unc13b UTSW 4 43,173,282 (GRCm39) missense unknown
R9382:Unc13b UTSW 4 43,172,512 (GRCm39) missense unknown
R9569:Unc13b UTSW 4 43,177,312 (GRCm39) small deletion probably benign
R9622:Unc13b UTSW 4 43,172,513 (GRCm39) missense
R9687:Unc13b UTSW 4 43,174,920 (GRCm39) missense unknown
R9704:Unc13b UTSW 4 43,237,102 (GRCm39) missense probably benign 0.31
R9721:Unc13b UTSW 4 43,101,869 (GRCm39) missense probably benign
R9753:Unc13b UTSW 4 43,182,842 (GRCm39) nonsense probably null
RF016:Unc13b UTSW 4 43,177,350 (GRCm39) small insertion probably benign
RF016:Unc13b UTSW 4 43,177,347 (GRCm39) small insertion probably benign
RF041:Unc13b UTSW 4 43,177,338 (GRCm39) small insertion probably benign
RF056:Unc13b UTSW 4 43,177,359 (GRCm39) small insertion probably benign
Z1176:Unc13b UTSW 4 43,177,764 (GRCm39) missense unknown
Z1176:Unc13b UTSW 4 43,177,191 (GRCm39) missense unknown
Z1176:Unc13b UTSW 4 43,171,419 (GRCm39) missense unknown
Z1176:Unc13b UTSW 4 43,261,043 (GRCm39) missense probably benign 0.11
Z1177:Unc13b UTSW 4 43,173,669 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GATCCAGAGAAACTTAACAGCATAG -3'
(R):5'- AAATGACAGAAAGGAAGCCTCTTTG -3'

Sequencing Primer
(F):5'- GAGGAATTTAATAAGAGTGACCAGAC -3'
(R):5'- CCTCTTTGGGTTCCTTTGTCAGAAG -3'
Posted On 2017-06-26