Mutagenetix > Incidental Mutations

Incidental Mutation 'R5994:Ube4b'

480990

Institutional Source

Beutler Lab

Gene Symbol

Ube4b

Ensembl Gene

ENSMUSG00000028960

Gene Name

ubiquitination factor E4B

Synonyms

UFD2a, 4930551I19Rik, Ufd2p, 4933406G05Rik, UFD2, D4Bwg0973e

MMRRC Submission

044173-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5994 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

149328416-149426749 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 149372932 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 283 (Y283H)

Ref Sequence

ENSEMBL: ENSMUSP00000134556 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103212] [ENSMUST00000172836] [ENSMUST00000174343]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000084123

Predicted Effect

probably benign
Transcript: ENSMUST00000103212
AA Change: Y283H

PolyPhen 2 Score 0.436 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000099501
Gene: ENSMUSG00000028960
AA Change: Y283H

Domain	Start	End	E-Value	Type
low complexity region	10	20	N/A	INTRINSIC
low complexity region	21	33	N/A	INTRINSIC
low complexity region	37	50	N/A	INTRINSIC
low complexity region	76	99	N/A	INTRINSIC
low complexity region	261	278	N/A	INTRINSIC
low complexity region	439	452	N/A	INTRINSIC
Pfam:Ufd2P_core	462	1083	1.3e-199	PFAM
Ubox	1102	1164	3.94e-25	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000172836
AA Change: Y283H

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000134452
Gene: ENSMUSG00000028960
AA Change: Y283H

Domain	Start	End	E-Value	Type
low complexity region	10	20	N/A	INTRINSIC
low complexity region	21	33	N/A	INTRINSIC
low complexity region	37	50	N/A	INTRINSIC
low complexity region	76	99	N/A	INTRINSIC
low complexity region	261	278	N/A	INTRINSIC
low complexity region	439	452	N/A	INTRINSIC
Pfam:Ufd2P_core	462	983	7.4e-143	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000174343
AA Change: Y283H

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000134556
Gene: ENSMUSG00000028960
AA Change: Y283H

Domain	Start	End	E-Value	Type
low complexity region	10	20	N/A	INTRINSIC
low complexity region	21	33	N/A	INTRINSIC
low complexity region	37	50	N/A	INTRINSIC
low complexity region	76	99	N/A	INTRINSIC
low complexity region	261	278	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 91.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes an additional conjugation factor, E4, which is involved in multiubiquitin chain assembly. This gene is also the strongest candidate in the neuroblastoma tumor suppressor genes. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene die by midgestation and exhibit cardiac development defects such as hemorrhage and cardiomyocyte apoptosis. Heterozygous mice exhibit axonal dystrophy in the nucleus gracilis, degeneration of Purkinje cells and gait abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	A	T	6: 121,670,903	H1118L	probably benign	Het
Abca8b	A	G	11: 109,949,766		probably null	Het
Abcb5	A	T	12: 118,965,260		probably null	Het
Adcy6	A	T	15: 98,593,664	I1016N	probably damaging	Het
Afg3l2	A	T	18: 67,429,070	C312S	probably damaging	Het
Ano8	C	T	8: 71,484,834	V89M	probably damaging	Het
Arhgap21	C	T	2: 20,881,376	G330D	possibly damaging	Het
Caskin1	T	C	17: 24,496,961	L195P	probably damaging	Het
Cfap54	A	G	10: 93,039,081	I514T	probably damaging	Het
Ctdsp2	G	A	10: 126,995,820		probably benign	Het
Cyp4x1	T	C	4: 115,121,945	I152V	probably benign	Het
Dglucy	G	A	12: 100,842,700	R219Q	probably benign	Het
Disp3	G	T	4: 148,254,284	A810E	possibly damaging	Het
Dtx4	T	C	19: 12,501,153	Y22C	probably damaging	Het
Edaradd	A	T	13: 12,478,496	I105N	probably damaging	Het
Eepd1	C	T	9: 25,603,453	P519S	probably damaging	Het
Fscn3	A	T	6: 28,430,295	S155C	probably benign	Het
Gm10134	A	T	2: 28,506,246	E51V	probably damaging	Het
Gm7247	C	T	14: 51,364,348	S26F	probably benign	Het
Golga7	T	C	8: 23,250,265	E83G	probably benign	Het
Gpr12	T	C	5: 146,583,431	H227R	probably damaging	Het
Hoxa2	T	G	6: 52,164,392	S85R	possibly damaging	Het
Hrnr	T	C	3: 93,332,300	S3282P	unknown	Het
Ift74	C	A	4: 94,691,724	T543K	possibly damaging	Het
Klf10	C	A	15: 38,296,041	R420L	probably damaging	Het
Krt77	T	A	15: 101,862,855	I338F	probably damaging	Het
Limch1	A	T	5: 66,974,622	S152C	probably damaging	Het
Mgat4e	T	A	1: 134,541,496	H270L	probably benign	Het
Myrf	A	T	19: 10,219,117	L504Q	probably null	Het
Nckipsd	A	G	9: 108,813,977	Q366R	probably benign	Het
Npy5r	A	T	8: 66,682,099	V14D	probably benign	Het
Nrap	T	A	19: 56,351,599	R830*	probably null	Het
Ogfrl1	A	T	1: 23,378,989	Y103N	probably damaging	Het
Olfr978	A	T	9: 39,994,223	R138*	probably null	Het
P2rx4	T	A	5: 122,725,079	L232H	probably damaging	Het
Pabpc2	A	T	18: 39,773,894	T71S	probably benign	Het
Paip2b	C	A	6: 83,808,885	S121I	probably damaging	Het
Pofut1	C	T	2: 153,261,229	T261I	possibly damaging	Het
Ppp6c	G	T	2: 39,210,992	T46K	possibly damaging	Het
Prkd2	C	A	7: 16,850,336	H371Q	probably benign	Het
Prrc2c	A	T	1: 162,674,156		probably null	Het
Psd3	C	T	8: 67,719,968	A894T	probably damaging	Het
Pygm	A	T	19: 6,398,043		probably null	Het
Pzp	A	T	6: 128,491,597	M989K	probably damaging	Het
Ralgapa2	A	T	2: 146,361,453	S1159T	probably benign	Het
Rapgefl1	T	C	11: 98,850,160	F575L	probably benign	Het
Rassf6	A	G	5: 90,617,768	L28S	probably damaging	Het
Rbp3	G	T	14: 33,954,900	K268N	probably damaging	Het
Rela	C	T	19: 5,647,064	T433M	possibly damaging	Het
Rnf103	T	A	6: 71,496,910	S102R	probably damaging	Het
Scarf2	A	G	16: 17,806,379	N516S	probably damaging	Het
Sdcbp2	T	C	2: 151,587,483	I241T	probably damaging	Het
Sept7	T	C	9: 25,288,198	I131T	possibly damaging	Het
Sh3pxd2b	T	C	11: 32,407,570	F191L	probably damaging	Het
Siglec15	C	A	18: 78,047,375	C236F	probably damaging	Het
Slc11a2	T	C	15: 100,397,681	T520A	probably benign	Het
Slc26a11	C	A	11: 119,379,912	F553L	probably benign	Het
Smchd1	G	A	17: 71,365,409	P1596S	possibly damaging	Het
Taar7b	A	G	10: 24,000,348	H137R	probably damaging	Het
Thap12	T	A	7: 98,716,030	C468*	probably null	Het
Timp4	C	T	6: 115,247,354	G118D	probably damaging	Het
Tnnt3	A	G	7: 142,511,266	K48E	probably damaging	Het
Trmt10a	T	A	3: 138,156,714	I255N	probably damaging	Het
Ttll10	T	C	4: 156,048,732		probably null	Het
Ucp1	G	T	8: 83,293,938	V126L	possibly damaging	Het
Unc13b	T	A	4: 43,172,596		probably benign	Het
Vps13b	T	C	15: 35,875,772	S2768P	probably damaging	Het
Zcchc6	T	G	13: 59,789,209	Y806S	probably damaging	Het
Zfp101	T	A	17: 33,380,962	M607L	probably benign	Het
Zfp292	C	T	4: 34,805,464	V2527M	possibly damaging	Het
Zfp503	T	A	14: 21,985,562	T429S	possibly damaging	Het

Other mutations in Ube4b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00672:Ube4b	APN	4	149381366	missense	probably benign	0.29
IGL00820:Ube4b	APN	4	149352921	splice site	probably benign
IGL01093:Ube4b	APN	4	149330269	missense	probably benign	0.01
IGL01154:Ube4b	APN	4	149365470	missense	probably benign	0.28
IGL01612:Ube4b	APN	4	149383818	missense	probably damaging	0.98
IGL01800:Ube4b	APN	4	149331494	missense	probably damaging	1.00
IGL02149:Ube4b	APN	4	149398684	missense	possibly damaging	0.88
IGL02472:Ube4b	APN	4	149387079	critical splice donor site	probably null
IGL02839:Ube4b	APN	4	149368399	missense	probably damaging	0.98
IGL03027:Ube4b	APN	4	149381277	missense	probably damaging	1.00
R0143:Ube4b	UTSW	4	149355457	missense	possibly damaging	0.61
R0164:Ube4b	UTSW	4	149360324	missense	probably damaging	0.98
R0164:Ube4b	UTSW	4	149360324	missense	probably damaging	0.98
R0206:Ube4b	UTSW	4	149398637	missense	probably benign	0.38
R0591:Ube4b	UTSW	4	149357577	intron	probably benign
R1366:Ube4b	UTSW	4	149335149	missense	probably damaging	0.98
R1452:Ube4b	UTSW	4	149371169	missense	probably damaging	1.00
R1513:Ube4b	UTSW	4	149351578	missense	probably benign	0.17
R1668:Ube4b	UTSW	4	149361294	missense	probably benign	0.02
R1874:Ube4b	UTSW	4	149347971	missense	probably damaging	1.00
R2002:Ube4b	UTSW	4	149383797	missense	probably benign	0.16
R2050:Ube4b	UTSW	4	149344612	missense	probably damaging	1.00
R2109:Ube4b	UTSW	4	149372841	missense	probably benign	0.00
R2281:Ube4b	UTSW	4	149344572	missense	probably damaging	1.00
R3547:Ube4b	UTSW	4	149335116	missense	probably damaging	1.00
R3881:Ube4b	UTSW	4	149365404	splice site	probably null
R4378:Ube4b	UTSW	4	149383798	missense	probably damaging	1.00
R4563:Ube4b	UTSW	4	149359165	intron	probably benign
R4674:Ube4b	UTSW	4	149331370	missense	possibly damaging	0.86
R4716:Ube4b	UTSW	4	149344612	missense	probably damaging	1.00
R5026:Ube4b	UTSW	4	149360565	missense	probably damaging	1.00
R5125:Ube4b	UTSW	4	149342992	missense	probably damaging	1.00
R5178:Ube4b	UTSW	4	149342992	missense	probably damaging	1.00
R5182:Ube4b	UTSW	4	149381242	missense	probably null	0.08
R5229:Ube4b	UTSW	4	149387178	missense	probably damaging	1.00
R5303:Ube4b	UTSW	4	149383803	missense	probably damaging	0.98
R5346:Ube4b	UTSW	4	149337424	missense	possibly damaging	0.91
R5780:Ube4b	UTSW	4	149331364	missense	probably benign	0.00
R5813:Ube4b	UTSW	4	149337468	missense	probably damaging	1.00
R5842:Ube4b	UTSW	4	149331430	missense	probably benign	0.01
R6020:Ube4b	UTSW	4	149368311	missense	probably benign	0.17
R6125:Ube4b	UTSW	4	149398746	missense	probably benign	0.13
R6272:Ube4b	UTSW	4	149387133	missense	probably damaging	1.00
R6333:Ube4b	UTSW	4	149348037	missense	probably damaging	1.00
R6426:Ube4b	UTSW	4	149425996	unclassified	probably benign
R7203:Ube4b	UTSW	4	149398610	missense	probably benign	0.30
R7341:Ube4b	UTSW	4	149343001	missense	probably damaging	1.00
R7672:Ube4b	UTSW	4	149387204	missense	probably benign	0.10
R7713:Ube4b	UTSW	4	149398781	missense	possibly damaging	0.53
R8175:Ube4b	UTSW	4	149351516	missense	probably benign	0.13
Z1088:Ube4b	UTSW	4	149335125	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- AGGTCTACAAGGTGCTGTGAG -3'
(R):5'- GCTGCATGGGGAAATTGTGC -3'

Sequencing Primer
(F):5'- GAGTTCTCCAGGACTAGATTCCG -3'
(R):5'- CATGGGGAAATTGTGCTTCACC -3'

Posted On

2017-06-26