Incidental Mutation 'R5994:Ube4b'
ID480990
Institutional Source Beutler Lab
Gene Symbol Ube4b
Ensembl Gene ENSMUSG00000028960
Gene Nameubiquitination factor E4B
SynonymsUFD2a, 4930551I19Rik, Ufd2p, 4933406G05Rik, UFD2, D4Bwg0973e
MMRRC Submission 044173-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5994 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location149328416-149426749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 149372932 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 283 (Y283H)
Ref Sequence ENSEMBL: ENSMUSP00000134556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103212] [ENSMUST00000172836] [ENSMUST00000174343]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000084123
Predicted Effect probably benign
Transcript: ENSMUST00000103212
AA Change: Y283H

PolyPhen 2 Score 0.436 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099501
Gene: ENSMUSG00000028960
AA Change: Y283H

DomainStartEndE-ValueType
low complexity region 10 20 N/A INTRINSIC
low complexity region 21 33 N/A INTRINSIC
low complexity region 37 50 N/A INTRINSIC
low complexity region 76 99 N/A INTRINSIC
low complexity region 261 278 N/A INTRINSIC
low complexity region 439 452 N/A INTRINSIC
Pfam:Ufd2P_core 462 1083 1.3e-199 PFAM
Ubox 1102 1164 3.94e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172836
AA Change: Y283H

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000134452
Gene: ENSMUSG00000028960
AA Change: Y283H

DomainStartEndE-ValueType
low complexity region 10 20 N/A INTRINSIC
low complexity region 21 33 N/A INTRINSIC
low complexity region 37 50 N/A INTRINSIC
low complexity region 76 99 N/A INTRINSIC
low complexity region 261 278 N/A INTRINSIC
low complexity region 439 452 N/A INTRINSIC
Pfam:Ufd2P_core 462 983 7.4e-143 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174343
AA Change: Y283H

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134556
Gene: ENSMUSG00000028960
AA Change: Y283H

DomainStartEndE-ValueType
low complexity region 10 20 N/A INTRINSIC
low complexity region 21 33 N/A INTRINSIC
low complexity region 37 50 N/A INTRINSIC
low complexity region 76 99 N/A INTRINSIC
low complexity region 261 278 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes an additional conjugation factor, E4, which is involved in multiubiquitin chain assembly. This gene is also the strongest candidate in the neuroblastoma tumor suppressor genes. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene die by midgestation and exhibit cardiac development defects such as hemorrhage and cardiomyocyte apoptosis. Heterozygous mice exhibit axonal dystrophy in the nucleus gracilis, degeneration of Purkinje cells and gait abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,670,903 H1118L probably benign Het
Abca8b A G 11: 109,949,766 probably null Het
Abcb5 A T 12: 118,965,260 probably null Het
Adcy6 A T 15: 98,593,664 I1016N probably damaging Het
Afg3l2 A T 18: 67,429,070 C312S probably damaging Het
Ano8 C T 8: 71,484,834 V89M probably damaging Het
Arhgap21 C T 2: 20,881,376 G330D possibly damaging Het
Caskin1 T C 17: 24,496,961 L195P probably damaging Het
Cfap54 A G 10: 93,039,081 I514T probably damaging Het
Ctdsp2 G A 10: 126,995,820 probably benign Het
Cyp4x1 T C 4: 115,121,945 I152V probably benign Het
Dglucy G A 12: 100,842,700 R219Q probably benign Het
Disp3 G T 4: 148,254,284 A810E possibly damaging Het
Dtx4 T C 19: 12,501,153 Y22C probably damaging Het
Edaradd A T 13: 12,478,496 I105N probably damaging Het
Eepd1 C T 9: 25,603,453 P519S probably damaging Het
Fscn3 A T 6: 28,430,295 S155C probably benign Het
Gm10134 A T 2: 28,506,246 E51V probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Golga7 T C 8: 23,250,265 E83G probably benign Het
Gpr12 T C 5: 146,583,431 H227R probably damaging Het
Hoxa2 T G 6: 52,164,392 S85R possibly damaging Het
Hrnr T C 3: 93,332,300 S3282P unknown Het
Ift74 C A 4: 94,691,724 T543K possibly damaging Het
Klf10 C A 15: 38,296,041 R420L probably damaging Het
Krt77 T A 15: 101,862,855 I338F probably damaging Het
Limch1 A T 5: 66,974,622 S152C probably damaging Het
Mgat4e T A 1: 134,541,496 H270L probably benign Het
Myrf A T 19: 10,219,117 L504Q probably null Het
Nckipsd A G 9: 108,813,977 Q366R probably benign Het
Npy5r A T 8: 66,682,099 V14D probably benign Het
Nrap T A 19: 56,351,599 R830* probably null Het
Ogfrl1 A T 1: 23,378,989 Y103N probably damaging Het
Olfr978 A T 9: 39,994,223 R138* probably null Het
P2rx4 T A 5: 122,725,079 L232H probably damaging Het
Pabpc2 A T 18: 39,773,894 T71S probably benign Het
Paip2b C A 6: 83,808,885 S121I probably damaging Het
Pofut1 C T 2: 153,261,229 T261I possibly damaging Het
Ppp6c G T 2: 39,210,992 T46K possibly damaging Het
Prkd2 C A 7: 16,850,336 H371Q probably benign Het
Prrc2c A T 1: 162,674,156 probably null Het
Psd3 C T 8: 67,719,968 A894T probably damaging Het
Pygm A T 19: 6,398,043 probably null Het
Pzp A T 6: 128,491,597 M989K probably damaging Het
Ralgapa2 A T 2: 146,361,453 S1159T probably benign Het
Rapgefl1 T C 11: 98,850,160 F575L probably benign Het
Rassf6 A G 5: 90,617,768 L28S probably damaging Het
Rbp3 G T 14: 33,954,900 K268N probably damaging Het
Rela C T 19: 5,647,064 T433M possibly damaging Het
Rnf103 T A 6: 71,496,910 S102R probably damaging Het
Scarf2 A G 16: 17,806,379 N516S probably damaging Het
Sdcbp2 T C 2: 151,587,483 I241T probably damaging Het
Sept7 T C 9: 25,288,198 I131T possibly damaging Het
Sh3pxd2b T C 11: 32,407,570 F191L probably damaging Het
Siglec15 C A 18: 78,047,375 C236F probably damaging Het
Slc11a2 T C 15: 100,397,681 T520A probably benign Het
Slc26a11 C A 11: 119,379,912 F553L probably benign Het
Smchd1 G A 17: 71,365,409 P1596S possibly damaging Het
Taar7b A G 10: 24,000,348 H137R probably damaging Het
Thap12 T A 7: 98,716,030 C468* probably null Het
Timp4 C T 6: 115,247,354 G118D probably damaging Het
Tnnt3 A G 7: 142,511,266 K48E probably damaging Het
Trmt10a T A 3: 138,156,714 I255N probably damaging Het
Ttll10 T C 4: 156,048,732 probably null Het
Ucp1 G T 8: 83,293,938 V126L possibly damaging Het
Unc13b T A 4: 43,172,596 probably benign Het
Vps13b T C 15: 35,875,772 S2768P probably damaging Het
Zcchc6 T G 13: 59,789,209 Y806S probably damaging Het
Zfp101 T A 17: 33,380,962 M607L probably benign Het
Zfp292 C T 4: 34,805,464 V2527M possibly damaging Het
Zfp503 T A 14: 21,985,562 T429S possibly damaging Het
Other mutations in Ube4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Ube4b APN 4 149381366 missense probably benign 0.29
IGL00820:Ube4b APN 4 149352921 splice site probably benign
IGL01093:Ube4b APN 4 149330269 missense probably benign 0.01
IGL01154:Ube4b APN 4 149365470 missense probably benign 0.28
IGL01612:Ube4b APN 4 149383818 missense probably damaging 0.98
IGL01800:Ube4b APN 4 149331494 missense probably damaging 1.00
IGL02149:Ube4b APN 4 149398684 missense possibly damaging 0.88
IGL02472:Ube4b APN 4 149387079 critical splice donor site probably null
IGL02839:Ube4b APN 4 149368399 missense probably damaging 0.98
IGL03027:Ube4b APN 4 149381277 missense probably damaging 1.00
R0143:Ube4b UTSW 4 149355457 missense possibly damaging 0.61
R0164:Ube4b UTSW 4 149360324 missense probably damaging 0.98
R0164:Ube4b UTSW 4 149360324 missense probably damaging 0.98
R0206:Ube4b UTSW 4 149398637 missense probably benign 0.38
R0591:Ube4b UTSW 4 149357577 intron probably benign
R1366:Ube4b UTSW 4 149335149 missense probably damaging 0.98
R1452:Ube4b UTSW 4 149371169 missense probably damaging 1.00
R1513:Ube4b UTSW 4 149351578 missense probably benign 0.17
R1668:Ube4b UTSW 4 149361294 missense probably benign 0.02
R1874:Ube4b UTSW 4 149347971 missense probably damaging 1.00
R2002:Ube4b UTSW 4 149383797 missense probably benign 0.16
R2050:Ube4b UTSW 4 149344612 missense probably damaging 1.00
R2109:Ube4b UTSW 4 149372841 missense probably benign 0.00
R2281:Ube4b UTSW 4 149344572 missense probably damaging 1.00
R3547:Ube4b UTSW 4 149335116 missense probably damaging 1.00
R3881:Ube4b UTSW 4 149365404 splice site probably null
R4378:Ube4b UTSW 4 149383798 missense probably damaging 1.00
R4563:Ube4b UTSW 4 149359165 intron probably benign
R4674:Ube4b UTSW 4 149331370 missense possibly damaging 0.86
R4716:Ube4b UTSW 4 149344612 missense probably damaging 1.00
R5026:Ube4b UTSW 4 149360565 missense probably damaging 1.00
R5125:Ube4b UTSW 4 149342992 missense probably damaging 1.00
R5178:Ube4b UTSW 4 149342992 missense probably damaging 1.00
R5182:Ube4b UTSW 4 149381242 missense probably null 0.08
R5229:Ube4b UTSW 4 149387178 missense probably damaging 1.00
R5303:Ube4b UTSW 4 149383803 missense probably damaging 0.98
R5346:Ube4b UTSW 4 149337424 missense possibly damaging 0.91
R5780:Ube4b UTSW 4 149331364 missense probably benign 0.00
R5813:Ube4b UTSW 4 149337468 missense probably damaging 1.00
R5842:Ube4b UTSW 4 149331430 missense probably benign 0.01
R6020:Ube4b UTSW 4 149368311 missense probably benign 0.17
R6125:Ube4b UTSW 4 149398746 missense probably benign 0.13
R6272:Ube4b UTSW 4 149387133 missense probably damaging 1.00
R6333:Ube4b UTSW 4 149348037 missense probably damaging 1.00
R6426:Ube4b UTSW 4 149425996 unclassified probably benign
R7203:Ube4b UTSW 4 149398610 missense probably benign 0.30
R7341:Ube4b UTSW 4 149343001 missense probably damaging 1.00
R7672:Ube4b UTSW 4 149387204 missense probably benign 0.10
R7713:Ube4b UTSW 4 149398781 missense possibly damaging 0.53
R8175:Ube4b UTSW 4 149351516 missense probably benign 0.13
Z1088:Ube4b UTSW 4 149335125 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AGGTCTACAAGGTGCTGTGAG -3'
(R):5'- GCTGCATGGGGAAATTGTGC -3'

Sequencing Primer
(F):5'- GAGTTCTCCAGGACTAGATTCCG -3'
(R):5'- CATGGGGAAATTGTGCTTCACC -3'
Posted On2017-06-26