Incidental Mutation 'R5994:Limch1'
ID480991
Institutional Source Beutler Lab
Gene Symbol Limch1
Ensembl Gene ENSMUSG00000037736
Gene NameLIM and calponin homology domains 1
Synonyms3732412D22Rik
MMRRC Submission 044173-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R5994 (G1)
Quality Score190.009
Status Not validated
Chromosome5
Chromosomal Location66745827-67057158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 66974622 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 152 (S152C)
Ref Sequence ENSEMBL: ENSMUSP00000123337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038188] [ENSMUST00000101164] [ENSMUST00000117601] [ENSMUST00000118242] [ENSMUST00000127184] [ENSMUST00000132991]
Predicted Effect probably damaging
Transcript: ENSMUST00000038188
AA Change: S143C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043163
Gene: ENSMUSG00000037736
AA Change: S143C

DomainStartEndE-ValueType
low complexity region 41 57 N/A INTRINSIC
low complexity region 67 80 N/A INTRINSIC
low complexity region 129 140 N/A INTRINSIC
coiled coil region 192 241 N/A INTRINSIC
low complexity region 411 430 N/A INTRINSIC
coiled coil region 615 672 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
LIM 830 888 5.08e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000101164
AA Change: S299C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098723
Gene: ENSMUSG00000037736
AA Change: S299C

DomainStartEndE-ValueType
CH 23 124 2.09e-13 SMART
low complexity region 197 213 N/A INTRINSIC
low complexity region 223 236 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
coiled coil region 348 397 N/A INTRINSIC
low complexity region 567 586 N/A INTRINSIC
coiled coil region 771 828 N/A INTRINSIC
low complexity region 835 847 N/A INTRINSIC
LIM 986 1044 5.08e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117601
AA Change: S140C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113544
Gene: ENSMUSG00000037736
AA Change: S140C

DomainStartEndE-ValueType
CH 23 124 1e-15 SMART
low complexity region 197 213 N/A INTRINSIC
low complexity region 223 236 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
coiled coil region 348 397 N/A INTRINSIC
low complexity region 567 586 N/A INTRINSIC
coiled coil region 704 752 N/A INTRINSIC
low complexity region 759 771 N/A INTRINSIC
LIM 910 968 2.4e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118242
AA Change: S299C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112732
Gene: ENSMUSG00000037736
AA Change: S299C

DomainStartEndE-ValueType
CH 23 124 2.09e-13 SMART
low complexity region 197 213 N/A INTRINSIC
low complexity region 223 236 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
coiled coil region 336 385 N/A INTRINSIC
low complexity region 555 574 N/A INTRINSIC
coiled coil region 782 839 N/A INTRINSIC
low complexity region 846 858 N/A INTRINSIC
LIM 997 1055 5.08e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000119854
AA Change: S27C
SMART Domains Protein: ENSMUSP00000112651
Gene: ENSMUSG00000037736
AA Change: S27C

DomainStartEndE-ValueType
CH 23 124 2.09e-13 SMART
low complexity region 197 213 N/A INTRINSIC
low complexity region 223 236 N/A INTRINSIC
Pfam:DUF4757 250 418 5.2e-66 PFAM
low complexity region 567 586 N/A INTRINSIC
coiled coil region 771 828 N/A INTRINSIC
low complexity region 835 847 N/A INTRINSIC
low complexity region 989 1003 N/A INTRINSIC
LIM 1012 1070 5.08e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127184
AA Change: S143C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114681
Gene: ENSMUSG00000037736
AA Change: S143C

DomainStartEndE-ValueType
low complexity region 41 57 N/A INTRINSIC
low complexity region 67 80 N/A INTRINSIC
low complexity region 129 140 N/A INTRINSIC
coiled coil region 180 229 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132991
AA Change: S152C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123337
Gene: ENSMUSG00000037736
AA Change: S152C

DomainStartEndE-ValueType
low complexity region 50 66 N/A INTRINSIC
low complexity region 76 89 N/A INTRINSIC
Pfam:DUF4757 103 269 2.6e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140428
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201322
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201852
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202048
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,670,903 H1118L probably benign Het
Abca8b A G 11: 109,949,766 probably null Het
Abcb5 A T 12: 118,965,260 probably null Het
Adcy6 A T 15: 98,593,664 I1016N probably damaging Het
Afg3l2 A T 18: 67,429,070 C312S probably damaging Het
Ano8 C T 8: 71,484,834 V89M probably damaging Het
Arhgap21 C T 2: 20,881,376 G330D possibly damaging Het
Caskin1 T C 17: 24,496,961 L195P probably damaging Het
Cfap54 A G 10: 93,039,081 I514T probably damaging Het
Ctdsp2 G A 10: 126,995,820 probably benign Het
Cyp4x1 T C 4: 115,121,945 I152V probably benign Het
Dglucy G A 12: 100,842,700 R219Q probably benign Het
Disp3 G T 4: 148,254,284 A810E possibly damaging Het
Dtx4 T C 19: 12,501,153 Y22C probably damaging Het
Edaradd A T 13: 12,478,496 I105N probably damaging Het
Eepd1 C T 9: 25,603,453 P519S probably damaging Het
Fscn3 A T 6: 28,430,295 S155C probably benign Het
Gm10134 A T 2: 28,506,246 E51V probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Golga7 T C 8: 23,250,265 E83G probably benign Het
Gpr12 T C 5: 146,583,431 H227R probably damaging Het
Hoxa2 T G 6: 52,164,392 S85R possibly damaging Het
Hrnr T C 3: 93,332,300 S3282P unknown Het
Ift74 C A 4: 94,691,724 T543K possibly damaging Het
Klf10 C A 15: 38,296,041 R420L probably damaging Het
Krt77 T A 15: 101,862,855 I338F probably damaging Het
Mgat4e T A 1: 134,541,496 H270L probably benign Het
Myrf A T 19: 10,219,117 L504Q probably null Het
Nckipsd A G 9: 108,813,977 Q366R probably benign Het
Npy5r A T 8: 66,682,099 V14D probably benign Het
Nrap T A 19: 56,351,599 R830* probably null Het
Ogfrl1 A T 1: 23,378,989 Y103N probably damaging Het
Olfr978 A T 9: 39,994,223 R138* probably null Het
P2rx4 T A 5: 122,725,079 L232H probably damaging Het
Pabpc2 A T 18: 39,773,894 T71S probably benign Het
Paip2b C A 6: 83,808,885 S121I probably damaging Het
Pofut1 C T 2: 153,261,229 T261I possibly damaging Het
Ppp6c G T 2: 39,210,992 T46K possibly damaging Het
Prkd2 C A 7: 16,850,336 H371Q probably benign Het
Prrc2c A T 1: 162,674,156 probably null Het
Psd3 C T 8: 67,719,968 A894T probably damaging Het
Pygm A T 19: 6,398,043 probably null Het
Pzp A T 6: 128,491,597 M989K probably damaging Het
Ralgapa2 A T 2: 146,361,453 S1159T probably benign Het
Rapgefl1 T C 11: 98,850,160 F575L probably benign Het
Rassf6 A G 5: 90,617,768 L28S probably damaging Het
Rbp3 G T 14: 33,954,900 K268N probably damaging Het
Rela C T 19: 5,647,064 T433M possibly damaging Het
Rnf103 T A 6: 71,496,910 S102R probably damaging Het
Scarf2 A G 16: 17,806,379 N516S probably damaging Het
Sdcbp2 T C 2: 151,587,483 I241T probably damaging Het
Sept7 T C 9: 25,288,198 I131T possibly damaging Het
Sh3pxd2b T C 11: 32,407,570 F191L probably damaging Het
Siglec15 C A 18: 78,047,375 C236F probably damaging Het
Slc11a2 T C 15: 100,397,681 T520A probably benign Het
Slc26a11 C A 11: 119,379,912 F553L probably benign Het
Smchd1 G A 17: 71,365,409 P1596S possibly damaging Het
Taar7b A G 10: 24,000,348 H137R probably damaging Het
Thap12 T A 7: 98,716,030 C468* probably null Het
Timp4 C T 6: 115,247,354 G118D probably damaging Het
Tnnt3 A G 7: 142,511,266 K48E probably damaging Het
Trmt10a T A 3: 138,156,714 I255N probably damaging Het
Ttll10 T C 4: 156,048,732 probably null Het
Ube4b A G 4: 149,372,932 Y283H probably damaging Het
Ucp1 G T 8: 83,293,938 V126L possibly damaging Het
Unc13b T A 4: 43,172,596 probably benign Het
Vps13b T C 15: 35,875,772 S2768P probably damaging Het
Zcchc6 T G 13: 59,789,209 Y806S probably damaging Het
Zfp101 T A 17: 33,380,962 M607L probably benign Het
Zfp292 C T 4: 34,805,464 V2527M possibly damaging Het
Zfp503 T A 14: 21,985,562 T429S possibly damaging Het
Other mutations in Limch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Limch1 APN 5 66953679 missense probably damaging 0.99
IGL00644:Limch1 APN 5 67016552 missense probably benign 0.01
IGL00705:Limch1 APN 5 66993153 nonsense probably null
IGL01154:Limch1 APN 5 66745958 nonsense probably null 0.00
IGL01865:Limch1 APN 5 66974580 nonsense probably null
IGL02529:Limch1 APN 5 67002613 missense possibly damaging 0.89
IGL03171:Limch1 APN 5 67034194 missense possibly damaging 0.80
IGL03308:Limch1 APN 5 67002558 missense possibly damaging 0.92
IGL03396:Limch1 APN 5 66953673 missense probably damaging 1.00
R0067:Limch1 UTSW 5 66974622 missense probably damaging 0.99
R0067:Limch1 UTSW 5 66974622 missense probably damaging 0.99
R0114:Limch1 UTSW 5 67036084 intron probably benign
R0129:Limch1 UTSW 5 66959590 missense probably damaging 0.96
R0193:Limch1 UTSW 5 67027539 missense probably damaging 1.00
R0194:Limch1 UTSW 5 66999273 missense probably benign 0.05
R0367:Limch1 UTSW 5 66857954 critical splice donor site probably null
R0558:Limch1 UTSW 5 66969155 missense probably damaging 1.00
R0927:Limch1 UTSW 5 66997233 missense probably damaging 1.00
R1190:Limch1 UTSW 5 66969197 missense probably damaging 1.00
R1316:Limch1 UTSW 5 66999243 missense probably damaging 1.00
R1469:Limch1 UTSW 5 66881980 splice site probably benign
R1647:Limch1 UTSW 5 66999256 missense probably damaging 1.00
R1648:Limch1 UTSW 5 66999256 missense probably damaging 1.00
R1944:Limch1 UTSW 5 66999099 missense probably damaging 1.00
R2103:Limch1 UTSW 5 66998729 missense probably benign 0.05
R2126:Limch1 UTSW 5 67029760 missense probably damaging 1.00
R2248:Limch1 UTSW 5 67044399 missense probably damaging 1.00
R2415:Limch1 UTSW 5 66974634 missense probably damaging 1.00
R3762:Limch1 UTSW 5 67028840 missense probably damaging 1.00
R3797:Limch1 UTSW 5 66969079 missense probably damaging 1.00
R4659:Limch1 UTSW 5 67027557 missense probably damaging 1.00
R4773:Limch1 UTSW 5 67027507 missense probably damaging 0.99
R4876:Limch1 UTSW 5 66881927 missense possibly damaging 0.64
R5062:Limch1 UTSW 5 66969235 missense probably damaging 1.00
R5191:Limch1 UTSW 5 67027561 missense probably damaging 1.00
R5202:Limch1 UTSW 5 66993173 missense probably damaging 1.00
R5335:Limch1 UTSW 5 66881957 missense probably damaging 1.00
R5436:Limch1 UTSW 5 66974566 missense possibly damaging 0.72
R6049:Limch1 UTSW 5 67030860 missense probably benign 0.32
R6228:Limch1 UTSW 5 67016502 missense probably damaging 1.00
R6547:Limch1 UTSW 5 67028774 missense probably damaging 1.00
R6600:Limch1 UTSW 5 66745938 missense probably benign
R6888:Limch1 UTSW 5 67021926 missense probably benign 0.21
R7111:Limch1 UTSW 5 67025176 splice site probably null
R7132:Limch1 UTSW 5 66953685 missense probably damaging 1.00
R7144:Limch1 UTSW 5 67017658 missense probably benign 0.10
R7302:Limch1 UTSW 5 66959599 missense probably benign 0.02
R7341:Limch1 UTSW 5 67034202 missense probably benign 0.06
R7491:Limch1 UTSW 5 67054237 missense probably damaging 0.99
R8079:Limch1 UTSW 5 67046753 missense possibly damaging 0.73
R8229:Limch1 UTSW 5 67028795 missense probably damaging 1.00
R8348:Limch1 UTSW 5 67002482 missense probably damaging 0.98
R8395:Limch1 UTSW 5 66969051 missense probably damaging 0.96
R8416:Limch1 UTSW 5 66999306 missense probably benign
R8448:Limch1 UTSW 5 67002482 missense probably damaging 0.98
R8477:Limch1 UTSW 5 66974565 missense probably benign 0.01
R8924:Limch1 UTSW 5 67033132 missense probably benign 0.01
X0022:Limch1 UTSW 5 67021952 missense probably benign 0.00
X0027:Limch1 UTSW 5 67002620 missense probably damaging 1.00
Z1177:Limch1 UTSW 5 67028799 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGGAAGTTGCCAGATGTGAAG -3'
(R):5'- CATGGTCAACAGAACTGGCC -3'

Sequencing Primer
(F):5'- TGTGAAGAAAGATGATATGTCCGCAC -3'
(R):5'- GCTCCTCAGCAAAGTATATGTTG -3'
Posted On2017-06-26