Incidental Mutation 'R5994:P2rx4'
ID 480993
Institutional Source Beutler Lab
Gene Symbol P2rx4
Ensembl Gene ENSMUSG00000029470
Gene Name purinergic receptor P2X, ligand-gated ion channel 4
Synonyms D5Ertd444e, P2X4
MMRRC Submission 044173-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5994 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 122707544-122729738 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 122725079 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 232 (L232H)
Ref Sequence ENSEMBL: ENSMUSP00000117193 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031429] [ENSMUST00000081554] [ENSMUST00000139631] [ENSMUST00000142664] [ENSMUST00000198560]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000031429
AA Change: L232H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031429
Gene: ENSMUSG00000029470
AA Change: L232H

DomainStartEndE-ValueType
Pfam:P2X_receptor 13 381 3e-175 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000081554
AA Change: L205H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080269
Gene: ENSMUSG00000029470
AA Change: L205H

DomainStartEndE-ValueType
Pfam:P2X_receptor 13 176 1.6e-72 PFAM
Pfam:P2X_receptor 170 361 2.7e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132062
Predicted Effect probably damaging
Transcript: ENSMUST00000139631
AA Change: L205H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118163
Gene: ENSMUSG00000029470
AA Change: L205H

DomainStartEndE-ValueType
Pfam:P2X_receptor 13 176 3.7e-73 PFAM
Pfam:P2X_receptor 171 301 4.6e-59 PFAM
Pfam:P2X_receptor 299 331 1.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139712
Predicted Effect probably damaging
Transcript: ENSMUST00000142664
AA Change: L232H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117193
Gene: ENSMUSG00000029470
AA Change: L232H

DomainStartEndE-ValueType
Pfam:P2X_receptor 13 358 2.7e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198560
SMART Domains Protein: ENSMUSP00000142849
Gene: ENSMUSG00000029470

DomainStartEndE-ValueType
Pfam:P2X_receptor 13 47 6.9e-9 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel with high calcium permeability. The main pharmacological distinction between the members of the purinoceptor family is the relative sensitivity to the antagonists suramin and PPADS. The product of this gene has the lowest sensitivity for these antagonists. Multiple alternatively spliced transcript variants, some protein-coding and some not protein-coding, have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutation of this gene results in hypertension, abnormal artery morphology, abnormal nitric oxide homeostasis, and impaired flow induced vascular remodeling and vasodilation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,670,903 H1118L probably benign Het
Abca8b A G 11: 109,949,766 probably null Het
Abcb5 A T 12: 118,965,260 probably null Het
Adcy6 A T 15: 98,593,664 I1016N probably damaging Het
Afg3l2 A T 18: 67,429,070 C312S probably damaging Het
Ano8 C T 8: 71,484,834 V89M probably damaging Het
Arhgap21 C T 2: 20,881,376 G330D possibly damaging Het
Caskin1 T C 17: 24,496,961 L195P probably damaging Het
Cfap54 A G 10: 93,039,081 I514T probably damaging Het
Ctdsp2 G A 10: 126,995,820 probably benign Het
Cyp4x1 T C 4: 115,121,945 I152V probably benign Het
Dglucy G A 12: 100,842,700 R219Q probably benign Het
Disp3 G T 4: 148,254,284 A810E possibly damaging Het
Dtx4 T C 19: 12,501,153 Y22C probably damaging Het
Edaradd A T 13: 12,478,496 I105N probably damaging Het
Eepd1 C T 9: 25,603,453 P519S probably damaging Het
Fscn3 A T 6: 28,430,295 S155C probably benign Het
Gm10134 A T 2: 28,506,246 E51V probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Golga7 T C 8: 23,250,265 E83G probably benign Het
Gpr12 T C 5: 146,583,431 H227R probably damaging Het
Hoxa2 T G 6: 52,164,392 S85R possibly damaging Het
Hrnr T C 3: 93,332,300 S3282P unknown Het
Ift74 C A 4: 94,691,724 T543K possibly damaging Het
Klf10 C A 15: 38,296,041 R420L probably damaging Het
Krt77 T A 15: 101,862,855 I338F probably damaging Het
Limch1 A T 5: 66,974,622 S152C probably damaging Het
Mgat4e T A 1: 134,541,496 H270L probably benign Het
Myrf A T 19: 10,219,117 L504Q probably null Het
Nckipsd A G 9: 108,813,977 Q366R probably benign Het
Npy5r A T 8: 66,682,099 V14D probably benign Het
Nrap T A 19: 56,351,599 R830* probably null Het
Ogfrl1 A T 1: 23,378,989 Y103N probably damaging Het
Olfr978 A T 9: 39,994,223 R138* probably null Het
Pabpc2 A T 18: 39,773,894 T71S probably benign Het
Paip2b C A 6: 83,808,885 S121I probably damaging Het
Pofut1 C T 2: 153,261,229 T261I possibly damaging Het
Ppp6c G T 2: 39,210,992 T46K possibly damaging Het
Prkd2 C A 7: 16,850,336 H371Q probably benign Het
Prrc2c A T 1: 162,674,156 probably null Het
Psd3 C T 8: 67,719,968 A894T probably damaging Het
Pygm A T 19: 6,398,043 probably null Het
Pzp A T 6: 128,491,597 M989K probably damaging Het
Ralgapa2 A T 2: 146,361,453 S1159T probably benign Het
Rapgefl1 T C 11: 98,850,160 F575L probably benign Het
Rassf6 A G 5: 90,617,768 L28S probably damaging Het
Rbp3 G T 14: 33,954,900 K268N probably damaging Het
Rela C T 19: 5,647,064 T433M possibly damaging Het
Rnf103 T A 6: 71,496,910 S102R probably damaging Het
Scarf2 A G 16: 17,806,379 N516S probably damaging Het
Sdcbp2 T C 2: 151,587,483 I241T probably damaging Het
Sept7 T C 9: 25,288,198 I131T possibly damaging Het
Sh3pxd2b T C 11: 32,407,570 F191L probably damaging Het
Siglec15 C A 18: 78,047,375 C236F probably damaging Het
Slc11a2 T C 15: 100,397,681 T520A probably benign Het
Slc26a11 C A 11: 119,379,912 F553L probably benign Het
Smchd1 G A 17: 71,365,409 P1596S possibly damaging Het
Taar7b A G 10: 24,000,348 H137R probably damaging Het
Thap12 T A 7: 98,716,030 C468* probably null Het
Timp4 C T 6: 115,247,354 G118D probably damaging Het
Tnnt3 A G 7: 142,511,266 K48E probably damaging Het
Trmt10a T A 3: 138,156,714 I255N probably damaging Het
Ttll10 T C 4: 156,048,732 probably null Het
Ube4b A G 4: 149,372,932 Y283H probably damaging Het
Ucp1 G T 8: 83,293,938 V126L possibly damaging Het
Unc13b T A 4: 43,172,596 probably benign Het
Vps13b T C 15: 35,875,772 S2768P probably damaging Het
Zcchc6 T G 13: 59,789,209 Y806S probably damaging Het
Zfp101 T A 17: 33,380,962 M607L probably benign Het
Zfp292 C T 4: 34,805,464 V2527M possibly damaging Het
Zfp503 T A 14: 21,985,562 T429S possibly damaging Het
Other mutations in P2rx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0709:P2rx4 UTSW 5 122714404 missense probably damaging 1.00
R1081:P2rx4 UTSW 5 122727233 missense probably damaging 0.98
R1464:P2rx4 UTSW 5 122714539 missense probably damaging 0.97
R1464:P2rx4 UTSW 5 122714539 missense probably damaging 0.97
R3434:P2rx4 UTSW 5 122725070 missense probably damaging 1.00
R3435:P2rx4 UTSW 5 122725070 missense probably damaging 1.00
R5090:P2rx4 UTSW 5 122725055 missense probably damaging 1.00
R5318:P2rx4 UTSW 5 122719148 missense probably null 1.00
R5888:P2rx4 UTSW 5 122719165 missense probably benign
R5888:P2rx4 UTSW 5 122727208 missense probably damaging 1.00
R6450:P2rx4 UTSW 5 122727241 missense possibly damaging 0.88
R6478:P2rx4 UTSW 5 122707700 missense probably damaging 0.99
R6847:P2rx4 UTSW 5 122727751 missense probably damaging 1.00
X0064:P2rx4 UTSW 5 122707779 nonsense probably null
X0066:P2rx4 UTSW 5 122707745 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GGCTGCAGAAAACTTCACCC -3'
(R):5'- ATACCCATGATGCCTCCCTG -3'

Sequencing Primer
(F):5'- TCCATAACGAGATCTGGTGC -3'
(R):5'- CCTGTGGGGAAAGCAGG -3'
Posted On 2017-06-26