Incidental Mutation 'R5994:Hoxa2'
ID480996
Institutional Source Beutler Lab
Gene Symbol Hoxa2
Ensembl Gene ENSMUSG00000014704
Gene Namehomeobox A2
SynonymsHox-1.11
MMRRC Submission 044173-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5994 (G1)
Quality Score110.008
Status Not validated
Chromosome6
Chromosomal Location52162417-52164831 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 52164392 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 85 (S85R)
Ref Sequence ENSEMBL: ENSMUSP00000014848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014848] [ENSMUST00000114434] [ENSMUST00000128102]
Predicted Effect possibly damaging
Transcript: ENSMUST00000014848
AA Change: S85R

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000014848
Gene: ENSMUSG00000014704
AA Change: S85R

DomainStartEndE-ValueType
low complexity region 34 48 N/A INTRINSIC
low complexity region 101 116 N/A INTRINSIC
HOX 139 201 2.37e-28 SMART
low complexity region 214 227 N/A INTRINSIC
low complexity region 332 367 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114434
SMART Domains Protein: ENSMUSP00000110077
Gene: ENSMUSG00000079560

DomainStartEndE-ValueType
low complexity region 76 131 N/A INTRINSIC
HOX 192 254 3.35e-28 SMART
low complexity region 287 302 N/A INTRINSIC
low complexity region 304 326 N/A INTRINSIC
Pfam:DUF4074 377 441 9e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114435
Predicted Effect probably benign
Transcript: ENSMUST00000128102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155922
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159006
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183920
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189230
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is located in a cluster of developmentally and temporally regulated genes on chromosome 6 encoding proteins involved in pattern formation. These proteins contain a characteristic DNA-binding motif called a homeodomain and function in transcriptional regulation. There are four distinct clusters of related genes on chromosomes 2, 6, 11, and 15. The protein encoded by this gene is expressed in rhombomere 2 and is important for hindbrain formation in the early embryo. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mutant homozygotes lack skeletal elements normally derived from the second branchial arch and show duplication of elements derived from the first branchial arch, such as ossification centers of the middle ear. Mutants die perinatally with cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,670,903 H1118L probably benign Het
Abca8b A G 11: 109,949,766 probably null Het
Abcb5 A T 12: 118,965,260 probably null Het
Adcy6 A T 15: 98,593,664 I1016N probably damaging Het
Afg3l2 A T 18: 67,429,070 C312S probably damaging Het
Ano8 C T 8: 71,484,834 V89M probably damaging Het
Arhgap21 C T 2: 20,881,376 G330D possibly damaging Het
Caskin1 T C 17: 24,496,961 L195P probably damaging Het
Cfap54 A G 10: 93,039,081 I514T probably damaging Het
Ctdsp2 G A 10: 126,995,820 probably benign Het
Cyp4x1 T C 4: 115,121,945 I152V probably benign Het
Dglucy G A 12: 100,842,700 R219Q probably benign Het
Disp3 G T 4: 148,254,284 A810E possibly damaging Het
Dtx4 T C 19: 12,501,153 Y22C probably damaging Het
Edaradd A T 13: 12,478,496 I105N probably damaging Het
Eepd1 C T 9: 25,603,453 P519S probably damaging Het
Fscn3 A T 6: 28,430,295 S155C probably benign Het
Gm10134 A T 2: 28,506,246 E51V probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Golga7 T C 8: 23,250,265 E83G probably benign Het
Gpr12 T C 5: 146,583,431 H227R probably damaging Het
Hrnr T C 3: 93,332,300 S3282P unknown Het
Ift74 C A 4: 94,691,724 T543K possibly damaging Het
Klf10 C A 15: 38,296,041 R420L probably damaging Het
Krt77 T A 15: 101,862,855 I338F probably damaging Het
Limch1 A T 5: 66,974,622 S152C probably damaging Het
Mgat4e T A 1: 134,541,496 H270L probably benign Het
Myrf A T 19: 10,219,117 L504Q probably null Het
Nckipsd A G 9: 108,813,977 Q366R probably benign Het
Npy5r A T 8: 66,682,099 V14D probably benign Het
Nrap T A 19: 56,351,599 R830* probably null Het
Ogfrl1 A T 1: 23,378,989 Y103N probably damaging Het
Olfr978 A T 9: 39,994,223 R138* probably null Het
P2rx4 T A 5: 122,725,079 L232H probably damaging Het
Pabpc2 A T 18: 39,773,894 T71S probably benign Het
Paip2b C A 6: 83,808,885 S121I probably damaging Het
Pofut1 C T 2: 153,261,229 T261I possibly damaging Het
Ppp6c G T 2: 39,210,992 T46K possibly damaging Het
Prkd2 C A 7: 16,850,336 H371Q probably benign Het
Prrc2c A T 1: 162,674,156 probably null Het
Psd3 C T 8: 67,719,968 A894T probably damaging Het
Pygm A T 19: 6,398,043 probably null Het
Pzp A T 6: 128,491,597 M989K probably damaging Het
Ralgapa2 A T 2: 146,361,453 S1159T probably benign Het
Rapgefl1 T C 11: 98,850,160 F575L probably benign Het
Rassf6 A G 5: 90,617,768 L28S probably damaging Het
Rbp3 G T 14: 33,954,900 K268N probably damaging Het
Rela C T 19: 5,647,064 T433M possibly damaging Het
Rnf103 T A 6: 71,496,910 S102R probably damaging Het
Scarf2 A G 16: 17,806,379 N516S probably damaging Het
Sdcbp2 T C 2: 151,587,483 I241T probably damaging Het
Sept7 T C 9: 25,288,198 I131T possibly damaging Het
Sh3pxd2b T C 11: 32,407,570 F191L probably damaging Het
Siglec15 C A 18: 78,047,375 C236F probably damaging Het
Slc11a2 T C 15: 100,397,681 T520A probably benign Het
Slc26a11 C A 11: 119,379,912 F553L probably benign Het
Smchd1 G A 17: 71,365,409 P1596S possibly damaging Het
Taar7b A G 10: 24,000,348 H137R probably damaging Het
Thap12 T A 7: 98,716,030 C468* probably null Het
Timp4 C T 6: 115,247,354 G118D probably damaging Het
Tnnt3 A G 7: 142,511,266 K48E probably damaging Het
Trmt10a T A 3: 138,156,714 I255N probably damaging Het
Ttll10 T C 4: 156,048,732 probably null Het
Ube4b A G 4: 149,372,932 Y283H probably damaging Het
Ucp1 G T 8: 83,293,938 V126L possibly damaging Het
Unc13b T A 4: 43,172,596 probably benign Het
Vps13b T C 15: 35,875,772 S2768P probably damaging Het
Zcchc6 T G 13: 59,789,209 Y806S probably damaging Het
Zfp101 T A 17: 33,380,962 M607L probably benign Het
Zfp292 C T 4: 34,805,464 V2527M possibly damaging Het
Zfp503 T A 14: 21,985,562 T429S possibly damaging Het
Other mutations in Hoxa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Hoxa2 APN 6 52163517 missense probably damaging 1.00
R0111:Hoxa2 UTSW 6 52164487 splice site probably null
R0612:Hoxa2 UTSW 6 52163560 missense probably damaging 1.00
R1479:Hoxa2 UTSW 6 52163340 missense probably damaging 0.97
R1992:Hoxa2 UTSW 6 52164596 missense probably damaging 0.97
R2315:Hoxa2 UTSW 6 52162891 unclassified probably benign
R5703:Hoxa2 UTSW 6 52163263 missense probably damaging 0.98
R6168:Hoxa2 UTSW 6 52163481 missense probably damaging 1.00
R7483:Hoxa2 UTSW 6 52164299 missense probably benign 0.01
R7573:Hoxa2 UTSW 6 52163303 missense probably benign 0.25
R7708:Hoxa2 UTSW 6 52164562 missense probably damaging 0.99
R8215:Hoxa2 UTSW 6 52163061 missense probably damaging 1.00
R8548:Hoxa2 UTSW 6 52163118 missense probably damaging 1.00
R8683:Hoxa2 UTSW 6 52164560 missense possibly damaging 0.46
R8936:Hoxa2 UTSW 6 52163537 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCCTCGAAGCTCATGGTC -3'
(R):5'- CCTGTCGCTGATACATTTCAAAGTTC -3'

Sequencing Primer
(F):5'- AACCGCTCCTAGGGAAGC -3'
(R):5'- GTTCATCAATCAAGACCTCGACG -3'
Posted On2017-06-26