Incidental Mutation 'R5994:Rnf103'
ID480997
Institutional Source Beutler Lab
Gene Symbol Rnf103
Ensembl Gene ENSMUSG00000052656
Gene Namering finger protein 103
SynonymsZfp103, kf-1
MMRRC Submission 044173-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R5994 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location71493894-71510881 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71496910 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 102 (S102R)
Ref Sequence ENSEMBL: ENSMUSP00000109816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064637] [ENSMUST00000114178] [ENSMUST00000114179]
Predicted Effect probably damaging
Transcript: ENSMUST00000064637
AA Change: S102R

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000066324
Gene: ENSMUSG00000052656
AA Change: S102R

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 326 348 N/A INTRINSIC
transmembrane domain 353 375 N/A INTRINSIC
transmembrane domain 412 431 N/A INTRINSIC
low complexity region 523 531 N/A INTRINSIC
RING 619 660 5.07e-6 SMART
low complexity region 665 676 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114178
AA Change: S102R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109816
Gene: ENSMUSG00000052656
AA Change: S102R

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 162 173 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114179
AA Change: S102R

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109817
Gene: ENSMUSG00000052656
AA Change: S102R

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 326 348 N/A INTRINSIC
transmembrane domain 353 375 N/A INTRINSIC
transmembrane domain 412 431 N/A INTRINSIC
low complexity region 523 531 N/A INTRINSIC
RING 619 660 5.07e-6 SMART
low complexity region 665 676 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the RING finger family of E3 ubiquitin-protein ligases. These proteins catalyze the transfer of the ubiquitin protein from a ubiquitin E2 enzyme to a protein substrate. Homozygous knockout mice for this gene exhibit enhanced anxiety-like behavior. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for a knock-out allele display significantly increased anxiety-like behavior under stressful conditions as well as increased prepulse inhibition and a reduced startle amplitude with no detectable changes in exploratory locomotion or behavioral despair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,670,903 H1118L probably benign Het
Abca8b A G 11: 109,949,766 probably null Het
Abcb5 A T 12: 118,965,260 probably null Het
Adcy6 A T 15: 98,593,664 I1016N probably damaging Het
Afg3l2 A T 18: 67,429,070 C312S probably damaging Het
Ano8 C T 8: 71,484,834 V89M probably damaging Het
Arhgap21 C T 2: 20,881,376 G330D possibly damaging Het
Caskin1 T C 17: 24,496,961 L195P probably damaging Het
Cfap54 A G 10: 93,039,081 I514T probably damaging Het
Ctdsp2 G A 10: 126,995,820 probably benign Het
Cyp4x1 T C 4: 115,121,945 I152V probably benign Het
Dglucy G A 12: 100,842,700 R219Q probably benign Het
Disp3 G T 4: 148,254,284 A810E possibly damaging Het
Dtx4 T C 19: 12,501,153 Y22C probably damaging Het
Edaradd A T 13: 12,478,496 I105N probably damaging Het
Eepd1 C T 9: 25,603,453 P519S probably damaging Het
Fscn3 A T 6: 28,430,295 S155C probably benign Het
Gm10134 A T 2: 28,506,246 E51V probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Golga7 T C 8: 23,250,265 E83G probably benign Het
Gpr12 T C 5: 146,583,431 H227R probably damaging Het
Hoxa2 T G 6: 52,164,392 S85R possibly damaging Het
Hrnr T C 3: 93,332,300 S3282P unknown Het
Ift74 C A 4: 94,691,724 T543K possibly damaging Het
Klf10 C A 15: 38,296,041 R420L probably damaging Het
Krt77 T A 15: 101,862,855 I338F probably damaging Het
Limch1 A T 5: 66,974,622 S152C probably damaging Het
Mgat4e T A 1: 134,541,496 H270L probably benign Het
Myrf A T 19: 10,219,117 L504Q probably null Het
Nckipsd A G 9: 108,813,977 Q366R probably benign Het
Npy5r A T 8: 66,682,099 V14D probably benign Het
Nrap T A 19: 56,351,599 R830* probably null Het
Ogfrl1 A T 1: 23,378,989 Y103N probably damaging Het
Olfr978 A T 9: 39,994,223 R138* probably null Het
P2rx4 T A 5: 122,725,079 L232H probably damaging Het
Pabpc2 A T 18: 39,773,894 T71S probably benign Het
Paip2b C A 6: 83,808,885 S121I probably damaging Het
Pofut1 C T 2: 153,261,229 T261I possibly damaging Het
Ppp6c G T 2: 39,210,992 T46K possibly damaging Het
Prkd2 C A 7: 16,850,336 H371Q probably benign Het
Prrc2c A T 1: 162,674,156 probably null Het
Psd3 C T 8: 67,719,968 A894T probably damaging Het
Pygm A T 19: 6,398,043 probably null Het
Pzp A T 6: 128,491,597 M989K probably damaging Het
Ralgapa2 A T 2: 146,361,453 S1159T probably benign Het
Rapgefl1 T C 11: 98,850,160 F575L probably benign Het
Rassf6 A G 5: 90,617,768 L28S probably damaging Het
Rbp3 G T 14: 33,954,900 K268N probably damaging Het
Rela C T 19: 5,647,064 T433M possibly damaging Het
Scarf2 A G 16: 17,806,379 N516S probably damaging Het
Sdcbp2 T C 2: 151,587,483 I241T probably damaging Het
Sept7 T C 9: 25,288,198 I131T possibly damaging Het
Sh3pxd2b T C 11: 32,407,570 F191L probably damaging Het
Siglec15 C A 18: 78,047,375 C236F probably damaging Het
Slc11a2 T C 15: 100,397,681 T520A probably benign Het
Slc26a11 C A 11: 119,379,912 F553L probably benign Het
Smchd1 G A 17: 71,365,409 P1596S possibly damaging Het
Taar7b A G 10: 24,000,348 H137R probably damaging Het
Thap12 T A 7: 98,716,030 C468* probably null Het
Timp4 C T 6: 115,247,354 G118D probably damaging Het
Tnnt3 A G 7: 142,511,266 K48E probably damaging Het
Trmt10a T A 3: 138,156,714 I255N probably damaging Het
Ttll10 T C 4: 156,048,732 probably null Het
Ube4b A G 4: 149,372,932 Y283H probably damaging Het
Ucp1 G T 8: 83,293,938 V126L possibly damaging Het
Unc13b T A 4: 43,172,596 probably benign Het
Vps13b T C 15: 35,875,772 S2768P probably damaging Het
Zcchc6 T G 13: 59,789,209 Y806S probably damaging Het
Zfp101 T A 17: 33,380,962 M607L probably benign Het
Zfp292 C T 4: 34,805,464 V2527M possibly damaging Het
Zfp503 T A 14: 21,985,562 T429S possibly damaging Het
Other mutations in Rnf103
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Rnf103 APN 6 71509749 missense probably damaging 0.99
IGL00589:Rnf103 APN 6 71509083 missense probably benign 0.00
IGL01601:Rnf103 APN 6 71509183 missense probably damaging 1.00
IGL01732:Rnf103 APN 6 71510382 missense probably damaging 0.97
IGL02130:Rnf103 APN 6 71509564 missense probably damaging 1.00
IGL02227:Rnf103 APN 6 71510188 missense probably benign 0.01
IGL02386:Rnf103 APN 6 71509218 missense probably benign
IGL02532:Rnf103 APN 6 71509825 missense probably benign 0.19
IGL02532:Rnf103 APN 6 71509652 missense probably damaging 0.96
IGL02747:Rnf103 APN 6 71509177 missense probably damaging 0.97
IGL02839:Rnf103 APN 6 71509705 missense probably benign 0.41
IGL03247:Rnf103 APN 6 71510305 missense possibly damaging 0.78
R0140:Rnf103 UTSW 6 71509331 missense possibly damaging 0.76
R0308:Rnf103 UTSW 6 71509702 missense probably damaging 1.00
R0764:Rnf103 UTSW 6 71509582 missense probably damaging 0.96
R1428:Rnf103 UTSW 6 71508999 missense probably damaging 1.00
R2362:Rnf103 UTSW 6 71510017 missense probably benign 0.08
R3847:Rnf103 UTSW 6 71508875 missense probably damaging 1.00
R3849:Rnf103 UTSW 6 71508875 missense probably damaging 1.00
R3919:Rnf103 UTSW 6 71510347 missense probably benign 0.08
R4914:Rnf103 UTSW 6 71510264 missense possibly damaging 0.71
R5620:Rnf103 UTSW 6 71510008 missense probably benign 0.04
R5634:Rnf103 UTSW 6 71509617 missense probably benign 0.01
R5682:Rnf103 UTSW 6 71508724 intron probably benign
R5791:Rnf103 UTSW 6 71508925 missense probably damaging 0.99
R6347:Rnf103 UTSW 6 71505824 missense possibly damaging 0.89
R6551:Rnf103 UTSW 6 71510365 missense probably damaging 1.00
R7739:Rnf103 UTSW 6 71509479 missense possibly damaging 0.77
R7819:Rnf103 UTSW 6 71508930 missense probably benign 0.00
R7903:Rnf103 UTSW 6 71509154 missense probably damaging 1.00
R8750:Rnf103 UTSW 6 71509618 missense probably benign 0.11
R8784:Rnf103 UTSW 6 71509998 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GATGACCCCATTAGAATATATGCAC -3'
(R):5'- TGAGAACTGAGTTTTGCCTAGG -3'

Sequencing Primer
(F):5'- TTTGCTGATGTATTCAAAAGCTATTG -3'
(R):5'- CCTAGGAGGCAAACAGGAGGATAC -3'
Posted On2017-06-26