Incidental Mutation 'R5994:Rnf103'
ID 480997
Institutional Source Beutler Lab
Gene Symbol Rnf103
Ensembl Gene ENSMUSG00000052656
Gene Name ring finger protein 103
Synonyms Zfp103, kf-1
MMRRC Submission 044173-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.215) question?
Stock # R5994 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 71470878-71487865 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 71473894 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 102 (S102R)
Ref Sequence ENSEMBL: ENSMUSP00000109816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064637] [ENSMUST00000114178] [ENSMUST00000114179]
AlphaFold Q9R1W3
Predicted Effect probably damaging
Transcript: ENSMUST00000064637
AA Change: S102R

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000066324
Gene: ENSMUSG00000052656
AA Change: S102R

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 326 348 N/A INTRINSIC
transmembrane domain 353 375 N/A INTRINSIC
transmembrane domain 412 431 N/A INTRINSIC
low complexity region 523 531 N/A INTRINSIC
RING 619 660 5.07e-6 SMART
low complexity region 665 676 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114178
AA Change: S102R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109816
Gene: ENSMUSG00000052656
AA Change: S102R

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 162 173 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114179
AA Change: S102R

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109817
Gene: ENSMUSG00000052656
AA Change: S102R

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 326 348 N/A INTRINSIC
transmembrane domain 353 375 N/A INTRINSIC
transmembrane domain 412 431 N/A INTRINSIC
low complexity region 523 531 N/A INTRINSIC
RING 619 660 5.07e-6 SMART
low complexity region 665 676 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the RING finger family of E3 ubiquitin-protein ligases. These proteins catalyze the transfer of the ubiquitin protein from a ubiquitin E2 enzyme to a protein substrate. Homozygous knockout mice for this gene exhibit enhanced anxiety-like behavior. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for a knock-out allele display significantly increased anxiety-like behavior under stressful conditions as well as increased prepulse inhibition and a reduced startle amplitude with no detectable changes in exploratory locomotion or behavioral despair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,647,862 (GRCm39) H1118L probably benign Het
Abca8b A G 11: 109,840,592 (GRCm39) probably null Het
Abcb5 A T 12: 118,928,995 (GRCm39) probably null Het
Adcy6 A T 15: 98,491,545 (GRCm39) I1016N probably damaging Het
Afg3l2 A T 18: 67,562,140 (GRCm39) C312S probably damaging Het
Ano8 C T 8: 71,937,478 (GRCm39) V89M probably damaging Het
Arhgap21 C T 2: 20,886,187 (GRCm39) G330D possibly damaging Het
Caskin1 T C 17: 24,715,935 (GRCm39) L195P probably damaging Het
Cfap54 A G 10: 92,874,943 (GRCm39) I514T probably damaging Het
Ctdsp2 G A 10: 126,831,689 (GRCm39) probably benign Het
Cyp4x1 T C 4: 114,979,142 (GRCm39) I152V probably benign Het
Dglucy G A 12: 100,808,959 (GRCm39) R219Q probably benign Het
Disp3 G T 4: 148,338,741 (GRCm39) A810E possibly damaging Het
Dtx4 T C 19: 12,478,517 (GRCm39) Y22C probably damaging Het
Edaradd A T 13: 12,493,377 (GRCm39) I105N probably damaging Het
Eepd1 C T 9: 25,514,749 (GRCm39) P519S probably damaging Het
Fscn3 A T 6: 28,430,294 (GRCm39) S155C probably benign Het
Gm10134 A T 2: 28,396,258 (GRCm39) E51V probably damaging Het
Gm7247 C T 14: 51,601,805 (GRCm39) S26F probably benign Het
Golga7 T C 8: 23,740,281 (GRCm39) E83G probably benign Het
Gpr12 T C 5: 146,520,241 (GRCm39) H227R probably damaging Het
Hoxa2 T G 6: 52,141,372 (GRCm39) S85R possibly damaging Het
Hrnr T C 3: 93,239,607 (GRCm39) S3282P unknown Het
Ift74 C A 4: 94,579,961 (GRCm39) T543K possibly damaging Het
Klf10 C A 15: 38,296,285 (GRCm39) R420L probably damaging Het
Krt77 T A 15: 101,771,290 (GRCm39) I338F probably damaging Het
Limch1 A T 5: 67,131,965 (GRCm39) S152C probably damaging Het
Mgat4e T A 1: 134,469,234 (GRCm39) H270L probably benign Het
Myrf A T 19: 10,196,481 (GRCm39) L504Q probably null Het
Nckipsd A G 9: 108,691,176 (GRCm39) Q366R probably benign Het
Npy5r A T 8: 67,134,751 (GRCm39) V14D probably benign Het
Nrap T A 19: 56,340,031 (GRCm39) R830* probably null Het
Ogfrl1 A T 1: 23,418,070 (GRCm39) Y103N probably damaging Het
Or10g7 A T 9: 39,905,519 (GRCm39) R138* probably null Het
P2rx4 T A 5: 122,863,142 (GRCm39) L232H probably damaging Het
Pabpc2 A T 18: 39,906,947 (GRCm39) T71S probably benign Het
Paip2b C A 6: 83,785,867 (GRCm39) S121I probably damaging Het
Pofut1 C T 2: 153,103,149 (GRCm39) T261I possibly damaging Het
Ppp6c G T 2: 39,101,004 (GRCm39) T46K possibly damaging Het
Prkd2 C A 7: 16,584,261 (GRCm39) H371Q probably benign Het
Prrc2c A T 1: 162,501,725 (GRCm39) probably null Het
Psd3 C T 8: 68,172,620 (GRCm39) A894T probably damaging Het
Pygm A T 19: 6,448,073 (GRCm39) probably null Het
Pzp A T 6: 128,468,560 (GRCm39) M989K probably damaging Het
Ralgapa2 A T 2: 146,203,373 (GRCm39) S1159T probably benign Het
Rapgefl1 T C 11: 98,740,986 (GRCm39) F575L probably benign Het
Rassf6 A G 5: 90,765,627 (GRCm39) L28S probably damaging Het
Rbp3 G T 14: 33,676,857 (GRCm39) K268N probably damaging Het
Rela C T 19: 5,697,092 (GRCm39) T433M possibly damaging Het
Scarf2 A G 16: 17,624,243 (GRCm39) N516S probably damaging Het
Sdcbp2 T C 2: 151,429,403 (GRCm39) I241T probably damaging Het
Septin7 T C 9: 25,199,494 (GRCm39) I131T possibly damaging Het
Sh3pxd2b T C 11: 32,357,570 (GRCm39) F191L probably damaging Het
Siglec15 C A 18: 78,090,590 (GRCm39) C236F probably damaging Het
Slc11a2 T C 15: 100,295,562 (GRCm39) T520A probably benign Het
Slc26a11 C A 11: 119,270,738 (GRCm39) F553L probably benign Het
Smchd1 G A 17: 71,672,404 (GRCm39) P1596S possibly damaging Het
Taar7b A G 10: 23,876,246 (GRCm39) H137R probably damaging Het
Thap12 T A 7: 98,365,237 (GRCm39) C468* probably null Het
Timp4 C T 6: 115,224,315 (GRCm39) G118D probably damaging Het
Tnnt3 A G 7: 142,065,003 (GRCm39) K48E probably damaging Het
Trmt10a T A 3: 137,862,475 (GRCm39) I255N probably damaging Het
Ttll10 T C 4: 156,133,189 (GRCm39) probably null Het
Tut7 T G 13: 59,937,023 (GRCm39) Y806S probably damaging Het
Ube4b A G 4: 149,457,389 (GRCm39) Y283H probably damaging Het
Ucp1 G T 8: 84,020,567 (GRCm39) V126L possibly damaging Het
Unc13b T A 4: 43,172,596 (GRCm39) probably benign Het
Vps13b T C 15: 35,875,918 (GRCm39) S2768P probably damaging Het
Zfp101 T A 17: 33,599,936 (GRCm39) M607L probably benign Het
Zfp292 C T 4: 34,805,464 (GRCm39) V2527M possibly damaging Het
Zfp503 T A 14: 22,035,630 (GRCm39) T429S possibly damaging Het
Other mutations in Rnf103
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Rnf103 APN 6 71,486,733 (GRCm39) missense probably damaging 0.99
IGL00589:Rnf103 APN 6 71,486,067 (GRCm39) missense probably benign 0.00
IGL01601:Rnf103 APN 6 71,486,167 (GRCm39) missense probably damaging 1.00
IGL01732:Rnf103 APN 6 71,487,366 (GRCm39) missense probably damaging 0.97
IGL02130:Rnf103 APN 6 71,486,548 (GRCm39) missense probably damaging 1.00
IGL02227:Rnf103 APN 6 71,487,172 (GRCm39) missense probably benign 0.01
IGL02386:Rnf103 APN 6 71,486,202 (GRCm39) missense probably benign
IGL02532:Rnf103 APN 6 71,486,636 (GRCm39) missense probably damaging 0.96
IGL02532:Rnf103 APN 6 71,486,809 (GRCm39) missense probably benign 0.19
IGL02747:Rnf103 APN 6 71,486,161 (GRCm39) missense probably damaging 0.97
IGL02839:Rnf103 APN 6 71,486,689 (GRCm39) missense probably benign 0.41
IGL03247:Rnf103 APN 6 71,487,289 (GRCm39) missense possibly damaging 0.78
R0140:Rnf103 UTSW 6 71,486,315 (GRCm39) missense possibly damaging 0.76
R0308:Rnf103 UTSW 6 71,486,686 (GRCm39) missense probably damaging 1.00
R0764:Rnf103 UTSW 6 71,486,566 (GRCm39) missense probably damaging 0.96
R1428:Rnf103 UTSW 6 71,485,983 (GRCm39) missense probably damaging 1.00
R2362:Rnf103 UTSW 6 71,487,001 (GRCm39) missense probably benign 0.08
R3847:Rnf103 UTSW 6 71,485,859 (GRCm39) missense probably damaging 1.00
R3849:Rnf103 UTSW 6 71,485,859 (GRCm39) missense probably damaging 1.00
R3919:Rnf103 UTSW 6 71,487,331 (GRCm39) missense probably benign 0.08
R4914:Rnf103 UTSW 6 71,487,248 (GRCm39) missense possibly damaging 0.71
R5620:Rnf103 UTSW 6 71,486,992 (GRCm39) missense probably benign 0.04
R5634:Rnf103 UTSW 6 71,486,601 (GRCm39) missense probably benign 0.01
R5682:Rnf103 UTSW 6 71,485,708 (GRCm39) intron probably benign
R5791:Rnf103 UTSW 6 71,485,909 (GRCm39) missense probably damaging 0.99
R6347:Rnf103 UTSW 6 71,482,808 (GRCm39) missense possibly damaging 0.89
R6551:Rnf103 UTSW 6 71,487,349 (GRCm39) missense probably damaging 1.00
R7739:Rnf103 UTSW 6 71,486,463 (GRCm39) missense possibly damaging 0.77
R7819:Rnf103 UTSW 6 71,485,914 (GRCm39) missense probably benign 0.00
R7903:Rnf103 UTSW 6 71,486,138 (GRCm39) missense probably damaging 1.00
R8750:Rnf103 UTSW 6 71,486,602 (GRCm39) missense probably benign 0.11
R8784:Rnf103 UTSW 6 71,486,982 (GRCm39) missense probably benign 0.03
R8974:Rnf103 UTSW 6 71,486,092 (GRCm39) missense probably damaging 0.98
R9154:Rnf103 UTSW 6 71,487,099 (GRCm39) missense probably benign 0.06
R9505:Rnf103 UTSW 6 71,487,049 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GATGACCCCATTAGAATATATGCAC -3'
(R):5'- TGAGAACTGAGTTTTGCCTAGG -3'

Sequencing Primer
(F):5'- TTTGCTGATGTATTCAAAAGCTATTG -3'
(R):5'- CCTAGGAGGCAAACAGGAGGATAC -3'
Posted On 2017-06-26