Incidental Mutation 'R5994:Timp4'
ID 480999
Institutional Source Beutler Lab
Gene Symbol Timp4
Ensembl Gene ENSMUSG00000030317
Gene Name tissue inhibitor of metalloproteinase 4
Synonyms TIMP-4
MMRRC Submission 044173-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock # R5994 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 115241892-115252205 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 115247354 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 118 (G118D)
Ref Sequence ENSEMBL: ENSMUSP00000144785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009538] [ENSMUST00000032462] [ENSMUST00000166681] [ENSMUST00000169345] [ENSMUST00000203450] [ENSMUST00000205131]
AlphaFold Q9JHB3
Predicted Effect probably benign
Transcript: ENSMUST00000009538
SMART Domains Protein: ENSMUSP00000009538
Gene: ENSMUSG00000009394

DomainStartEndE-ValueType
Pfam:Synapsin_N 2 33 3.4e-24 PFAM
Pfam:Synapsin 112 213 6.4e-48 PFAM
Pfam:Synapsin_C 215 417 8.2e-140 PFAM
low complexity region 450 470 N/A INTRINSIC
low complexity region 473 507 N/A INTRINSIC
low complexity region 524 540 N/A INTRINSIC
low complexity region 551 562 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000032462
AA Change: G118D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032462
Gene: ENSMUSG00000030317
AA Change: G118D

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
NTR 30 207 1.85e-122 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166681
Predicted Effect probably benign
Transcript: ENSMUST00000169345
SMART Domains Protein: ENSMUSP00000133121
Gene: ENSMUSG00000009394

DomainStartEndE-ValueType
Pfam:Synapsin_N 2 33 1.3e-24 PFAM
Pfam:Synapsin 109 213 1.6e-62 PFAM
Pfam:Synapsin_C 215 417 4.4e-133 PFAM
Pfam:RimK 247 403 4.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203450
SMART Domains Protein: ENSMUSP00000144921
Gene: ENSMUSG00000009394

DomainStartEndE-ValueType
Pfam:Synapsin_N 2 33 2.7e-24 PFAM
Pfam:Synapsin 112 213 4.6e-48 PFAM
Pfam:Synapsin_C 215 417 5.3e-140 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203707
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204617
Predicted Effect probably damaging
Transcript: ENSMUST00000205131
AA Change: G118D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144785
Gene: ENSMUSG00000030317
AA Change: G118D

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
NTR 30 175 2.6e-76 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the TIMP gene family. The proteins encoded by this gene family are inhibitors of the matrix metalloproteinases, a group of peptidases involved in degradation of the extracellular matrix. The secreted, netrin domain-containing protein encoded by this gene is involved in regulation of platelet aggregation and recruitment and may play role in hormonal regulation and endometrial tissue remodeling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show increased lethality associated with left ventricle rupture following left anterior descending coronary artery ligation. Aged mice exhibit reduced myocardial performance index, decreased coronary flow rate, and increased left ventricle thickness and weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,670,903 H1118L probably benign Het
Abca8b A G 11: 109,949,766 probably null Het
Abcb5 A T 12: 118,965,260 probably null Het
Adcy6 A T 15: 98,593,664 I1016N probably damaging Het
Afg3l2 A T 18: 67,429,070 C312S probably damaging Het
Ano8 C T 8: 71,484,834 V89M probably damaging Het
Arhgap21 C T 2: 20,881,376 G330D possibly damaging Het
Caskin1 T C 17: 24,496,961 L195P probably damaging Het
Cfap54 A G 10: 93,039,081 I514T probably damaging Het
Ctdsp2 G A 10: 126,995,820 probably benign Het
Cyp4x1 T C 4: 115,121,945 I152V probably benign Het
Dglucy G A 12: 100,842,700 R219Q probably benign Het
Disp3 G T 4: 148,254,284 A810E possibly damaging Het
Dtx4 T C 19: 12,501,153 Y22C probably damaging Het
Edaradd A T 13: 12,478,496 I105N probably damaging Het
Eepd1 C T 9: 25,603,453 P519S probably damaging Het
Fscn3 A T 6: 28,430,295 S155C probably benign Het
Gm10134 A T 2: 28,506,246 E51V probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Golga7 T C 8: 23,250,265 E83G probably benign Het
Gpr12 T C 5: 146,583,431 H227R probably damaging Het
Hoxa2 T G 6: 52,164,392 S85R possibly damaging Het
Hrnr T C 3: 93,332,300 S3282P unknown Het
Ift74 C A 4: 94,691,724 T543K possibly damaging Het
Klf10 C A 15: 38,296,041 R420L probably damaging Het
Krt77 T A 15: 101,862,855 I338F probably damaging Het
Limch1 A T 5: 66,974,622 S152C probably damaging Het
Mgat4e T A 1: 134,541,496 H270L probably benign Het
Myrf A T 19: 10,219,117 L504Q probably null Het
Nckipsd A G 9: 108,813,977 Q366R probably benign Het
Npy5r A T 8: 66,682,099 V14D probably benign Het
Nrap T A 19: 56,351,599 R830* probably null Het
Ogfrl1 A T 1: 23,378,989 Y103N probably damaging Het
Olfr978 A T 9: 39,994,223 R138* probably null Het
P2rx4 T A 5: 122,725,079 L232H probably damaging Het
Pabpc2 A T 18: 39,773,894 T71S probably benign Het
Paip2b C A 6: 83,808,885 S121I probably damaging Het
Pofut1 C T 2: 153,261,229 T261I possibly damaging Het
Ppp6c G T 2: 39,210,992 T46K possibly damaging Het
Prkd2 C A 7: 16,850,336 H371Q probably benign Het
Prrc2c A T 1: 162,674,156 probably null Het
Psd3 C T 8: 67,719,968 A894T probably damaging Het
Pygm A T 19: 6,398,043 probably null Het
Pzp A T 6: 128,491,597 M989K probably damaging Het
Ralgapa2 A T 2: 146,361,453 S1159T probably benign Het
Rapgefl1 T C 11: 98,850,160 F575L probably benign Het
Rassf6 A G 5: 90,617,768 L28S probably damaging Het
Rbp3 G T 14: 33,954,900 K268N probably damaging Het
Rela C T 19: 5,647,064 T433M possibly damaging Het
Rnf103 T A 6: 71,496,910 S102R probably damaging Het
Scarf2 A G 16: 17,806,379 N516S probably damaging Het
Sdcbp2 T C 2: 151,587,483 I241T probably damaging Het
Sept7 T C 9: 25,288,198 I131T possibly damaging Het
Sh3pxd2b T C 11: 32,407,570 F191L probably damaging Het
Siglec15 C A 18: 78,047,375 C236F probably damaging Het
Slc11a2 T C 15: 100,397,681 T520A probably benign Het
Slc26a11 C A 11: 119,379,912 F553L probably benign Het
Smchd1 G A 17: 71,365,409 P1596S possibly damaging Het
Taar7b A G 10: 24,000,348 H137R probably damaging Het
Thap12 T A 7: 98,716,030 C468* probably null Het
Tnnt3 A G 7: 142,511,266 K48E probably damaging Het
Trmt10a T A 3: 138,156,714 I255N probably damaging Het
Ttll10 T C 4: 156,048,732 probably null Het
Ube4b A G 4: 149,372,932 Y283H probably damaging Het
Ucp1 G T 8: 83,293,938 V126L possibly damaging Het
Unc13b T A 4: 43,172,596 probably benign Het
Vps13b T C 15: 35,875,772 S2768P probably damaging Het
Zcchc6 T G 13: 59,789,209 Y806S probably damaging Het
Zfp101 T A 17: 33,380,962 M607L probably benign Het
Zfp292 C T 4: 34,805,464 V2527M possibly damaging Het
Zfp503 T A 14: 21,985,562 T429S possibly damaging Het
Other mutations in Timp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Timp4 APN 6 115246308 missense possibly damaging 0.73
IGL02267:Timp4 APN 6 115247279 missense possibly damaging 0.70
IGL02368:Timp4 APN 6 115246399 splice site probably null
IGL02501:Timp4 APN 6 115246483 missense probably damaging 1.00
IGL02636:Timp4 APN 6 115249824 splice site probably null
R0534:Timp4 UTSW 6 115249841 missense probably damaging 1.00
R0671:Timp4 UTSW 6 115249853 missense probably damaging 1.00
R1698:Timp4 UTSW 6 115250403 splice site probably null
R6433:Timp4 UTSW 6 115247220 missense probably damaging 1.00
R7537:Timp4 UTSW 6 115250460 missense probably damaging 0.96
R7869:Timp4 UTSW 6 115250394 missense probably benign 0.09
R9207:Timp4 UTSW 6 115247309 missense probably damaging 1.00
Z1177:Timp4 UTSW 6 115251777 start codon destroyed probably null 0.89
Predicted Primers PCR Primer
(F):5'- CACAATGTCAGTGTAGGAAGTG -3'
(R):5'- TAGGGCATAACTTCTGTGCG -3'

Sequencing Primer
(F):5'- GGTCAGGACCCTAAGGCTCTAAC -3'
(R):5'- CATAACTTCTGTGCGTGTGTATG -3'
Posted On 2017-06-26