Incidental Mutation 'R0514:Dhx34'
ID48100
Institutional Source Beutler Lab
Gene Symbol Dhx34
Ensembl Gene ENSMUSG00000006019
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 34
Synonyms1200013B07Rik, Ddx34, 1810012L18Rik
MMRRC Submission 038708-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.320) question?
Stock #R0514 (G1)
Quality Score185
Status Not validated
Chromosome7
Chromosomal Location16197147-16222037 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16210537 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 584 (Q584R)
Ref Sequence ENSEMBL: ENSMUSP00000126915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094816] [ENSMUST00000118795] [ENSMUST00000119102] [ENSMUST00000121123] [ENSMUST00000163968]
Predicted Effect probably benign
Transcript: ENSMUST00000094816
AA Change: Q584R

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000092410
Gene: ENSMUSG00000006019
AA Change: Q584R

DomainStartEndE-ValueType
low complexity region 4 26 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
DEXDc 150 343 7.73e-28 SMART
HELICc 400 498 4.31e-17 SMART
low complexity region 542 553 N/A INTRINSIC
HA2 558 648 3.35e-21 SMART
Pfam:OB_NTP_bind 687 911 2.6e-24 PFAM
low complexity region 953 971 N/A INTRINSIC
ZnF_C2H2 1121 1144 7.89e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118795
AA Change: Q584R

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000112865
Gene: ENSMUSG00000006019
AA Change: Q584R

DomainStartEndE-ValueType
low complexity region 4 26 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
DEXDc 150 343 7.73e-28 SMART
HELICc 400 498 4.31e-17 SMART
low complexity region 542 553 N/A INTRINSIC
HA2 558 648 3.35e-21 SMART
Pfam:OB_NTP_bind 687 911 7.5e-17 PFAM
low complexity region 953 971 N/A INTRINSIC
ZnF_C2H2 1121 1144 7.89e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119102
AA Change: Q584R

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000113393
Gene: ENSMUSG00000006019
AA Change: Q584R

DomainStartEndE-ValueType
low complexity region 4 26 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
DEXDc 150 343 7.73e-28 SMART
HELICc 400 498 4.31e-17 SMART
low complexity region 542 553 N/A INTRINSIC
HA2 558 648 3.35e-21 SMART
Pfam:OB_NTP_bind 687 911 7.5e-17 PFAM
low complexity region 953 971 N/A INTRINSIC
ZnF_C2H2 1121 1144 7.89e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121123
AA Change: Q584R

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000113673
Gene: ENSMUSG00000006019
AA Change: Q584R

DomainStartEndE-ValueType
low complexity region 4 26 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
DEXDc 150 343 7.73e-28 SMART
HELICc 400 498 4.31e-17 SMART
low complexity region 542 553 N/A INTRINSIC
HA2 558 648 3.35e-21 SMART
Pfam:OB_NTP_bind 687 911 7.5e-17 PFAM
low complexity region 953 971 N/A INTRINSIC
ZnF_C2H2 1121 1144 7.89e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133518
Predicted Effect probably benign
Transcript: ENSMUST00000163968
AA Change: Q584R

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000126915
Gene: ENSMUSG00000006019
AA Change: Q584R

DomainStartEndE-ValueType
low complexity region 4 26 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
DEXDc 150 343 7.73e-28 SMART
HELICc 400 498 4.31e-17 SMART
low complexity region 542 553 N/A INTRINSIC
HA2 558 648 3.35e-21 SMART
Pfam:OB_NTP_bind 687 911 6.4e-18 PFAM
low complexity region 953 971 N/A INTRINSIC
ZnF_C2H2 1121 1144 7.89e0 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. It is mapped to the glioma 19q tumor suppressor region and is a tumor suppressor candidate gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp T A 9: 104,319,978 Y154F probably damaging Het
Acsl6 A T 11: 54,350,580 D579V probably damaging Het
Adamts18 C T 8: 113,738,769 probably null Het
Adamts20 A T 15: 94,270,376 V1882D probably damaging Het
Add3 A T 19: 53,236,843 K465* probably null Het
Ago1 T G 4: 126,439,595 I524L probably benign Het
Akr1c18 A G 13: 4,137,191 M208T probably benign Het
Anapc1 C A 2: 128,632,655 L1413F probably damaging Het
Arid4b A T 13: 14,184,317 D646V probably damaging Het
Arnt2 T C 7: 84,304,859 E261G probably benign Het
Bccip C T 7: 133,719,130 T211I possibly damaging Het
Bsn T C 9: 108,125,782 S475G probably benign Het
Cdh26 G A 2: 178,466,828 probably null Het
Ceacam2 A G 7: 25,520,931 F414S probably benign Het
Cfb T C 17: 34,860,898 R172G probably damaging Het
Cntnap5b A C 1: 99,772,786 T8P probably benign Het
Cpne9 A T 6: 113,290,013 I136L probably damaging Het
Crtc1 A T 8: 70,402,429 probably null Het
Dcdc2a A T 13: 25,119,386 H300L probably benign Het
Dhdh C T 7: 45,488,706 V20M probably benign Het
Dis3l2 A G 1: 87,047,092 Y701C probably damaging Het
Dmrt2 T C 19: 25,675,655 probably null Het
Dnah5 A G 15: 28,366,321 T2727A probably damaging Het
Dopey1 A G 9: 86,520,734 E1329G probably damaging Het
Evpl A G 11: 116,223,291 V1191A probably damaging Het
Fam198a A G 9: 121,978,352 T521A possibly damaging Het
Fgfr1op A G 17: 8,191,434 N342S possibly damaging Het
Fhl4 T C 10: 85,098,386 D177G probably damaging Het
Heg1 A G 16: 33,726,756 T662A possibly damaging Het
Ifih1 A G 2: 62,623,391 probably null Het
Il13 T C 11: 53,632,518 R87G possibly damaging Het
Kcnc3 T A 7: 44,595,928 Y547* probably null Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lama1 G A 17: 67,764,698 G860D probably benign Het
Lmo7 T C 14: 101,887,173 L356P probably damaging Het
Lmo7 A T 14: 101,896,559 K447I probably damaging Het
Lrp2bp A G 8: 46,011,958 H38R probably damaging Het
Magi3 G A 3: 104,015,022 P1460S probably damaging Het
Megf8 T A 7: 25,364,303 C2695S possibly damaging Het
Mrgprb2 T G 7: 48,551,970 S336R probably benign Het
Mrgprx2 C T 7: 48,482,964 M1I probably null Het
Mug2 T C 6: 122,081,599 L1320P probably damaging Het
Noxred1 A G 12: 87,227,064 S68P probably benign Het
Olfr504 T A 7: 108,565,672 Y41F probably damaging Het
Olfr561 T A 7: 102,775,332 H269Q probably benign Het
Os9 C T 10: 127,119,639 C123Y probably damaging Het
Ostf1 T A 19: 18,596,359 T42S probably benign Het
Parg C A 14: 32,254,560 T186K possibly damaging Het
Pcnx T A 12: 81,995,110 M2172K probably benign Het
Pip4k2a A G 2: 18,845,936 I360T probably damaging Het
Pkn2 T C 3: 142,810,458 D568G possibly damaging Het
Plch2 A G 4: 154,998,886 S431P probably damaging Het
Prl8a6 A T 13: 27,433,007 C233* probably null Het
Prox1 G A 1: 190,161,456 T264I probably damaging Het
Prr5 A G 15: 84,702,766 N248S probably benign Het
Psip1 A C 4: 83,460,037 S407R probably damaging Het
Rab32 A T 10: 10,550,896 V102E probably damaging Het
Rap1gap2 T G 11: 74,388,854 K687Q possibly damaging Het
Rbak A T 5: 143,173,414 V628E probably damaging Het
Rnf148 T C 6: 23,654,793 E68G possibly damaging Het
Rnf212 A T 5: 108,749,442 S3T probably damaging Het
Rrad T G 8: 104,628,627 I250L probably benign Het
Sall4 T C 2: 168,755,705 H405R probably damaging Het
Scn9a T C 2: 66,483,678 R1888G probably damaging Het
Setd5 G T 6: 113,119,437 E535* probably null Het
Slc20a1 C T 2: 129,199,891 S58L probably damaging Het
Slc31a1 A G 4: 62,385,604 probably benign Het
Slc38a11 G T 2: 65,316,865 Q423K probably benign Het
Snrpd1 A T 18: 10,626,846 T38S possibly damaging Het
Taar4 A G 10: 23,960,882 D130G probably damaging Het
Tfb2m C T 1: 179,531,304 R338H probably benign Het
Tm2d2 A G 8: 25,022,726 I197V possibly damaging Het
Tmem132a C T 19: 10,858,991 G725D probably damaging Het
Tmem67 T C 4: 12,089,317 T38A probably benign Het
Tmprss15 A T 16: 78,968,267 S816T probably benign Het
Tnfrsf11a A G 1: 105,826,992 E263G probably damaging Het
Tnfrsf17 C T 16: 11,315,327 L90F probably benign Het
Tpr A G 1: 150,402,273 K117E possibly damaging Het
Trim43a C T 9: 88,584,336 Q5* probably null Het
Ubn1 A T 16: 5,073,071 D498V probably damaging Het
Vipr1 T A 9: 121,658,049 C63S probably damaging Het
Vmn1r237 T A 17: 21,314,670 H218Q possibly damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r95 T C 17: 18,451,582 V527A probably benign Het
Vmn2r97 A T 17: 18,914,472 T51S probably benign Het
Vwa8 G A 14: 78,947,189 V376I probably benign Het
Wdfy4 T A 14: 33,080,775 T1838S probably benign Het
Zcwpw1 A T 5: 137,796,683 E47V probably benign Het
Zeb2 T C 2: 45,002,647 E130G possibly damaging Het
Zfp111 A G 7: 24,199,143 Y348H probably damaging Het
Zfp53 T C 17: 21,509,009 S435P probably damaging Het
Other mutations in Dhx34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Dhx34 APN 7 16199826 missense probably damaging 1.00
IGL01090:Dhx34 APN 7 16216256 missense probably damaging 1.00
IGL01397:Dhx34 APN 7 16210543 missense probably damaging 1.00
IGL01637:Dhx34 APN 7 16205473 missense probably damaging 1.00
IGL01684:Dhx34 APN 7 16203279 missense probably damaging 1.00
IGL02147:Dhx34 APN 7 16204003 missense probably benign 0.01
IGL02223:Dhx34 APN 7 16198659 missense probably benign 0.10
R0255:Dhx34 UTSW 7 16205992 missense probably benign 0.32
R0919:Dhx34 UTSW 7 16201958 missense probably damaging 0.99
R1075:Dhx34 UTSW 7 16218349 missense probably benign 0.06
R1077:Dhx34 UTSW 7 16218368 missense probably damaging 0.97
R4197:Dhx34 UTSW 7 16203726 missense probably damaging 1.00
R4721:Dhx34 UTSW 7 16197382 missense possibly damaging 0.83
R4856:Dhx34 UTSW 7 16215442 missense possibly damaging 0.94
R4868:Dhx34 UTSW 7 16199802 missense probably benign 0.10
R5134:Dhx34 UTSW 7 16218250 missense possibly damaging 0.57
R5180:Dhx34 UTSW 7 16205480 nonsense probably null
R5560:Dhx34 UTSW 7 16218541 missense probably benign 0.34
R5588:Dhx34 UTSW 7 16198900 missense probably damaging 0.99
R6981:Dhx34 UTSW 7 16215330 missense possibly damaging 0.87
R6994:Dhx34 UTSW 7 16203874 missense probably benign 0.04
R7226:Dhx34 UTSW 7 16198876 missense probably damaging 1.00
R7262:Dhx34 UTSW 7 16203698 missense probably benign 0.01
R7288:Dhx34 UTSW 7 16215436 missense probably benign 0.08
R7381:Dhx34 UTSW 7 16215448 missense probably benign 0.00
R7469:Dhx34 UTSW 7 16216439 missense probably benign 0.00
R7709:Dhx34 UTSW 7 16212864 missense possibly damaging 0.55
R7862:Dhx34 UTSW 7 16210523 missense probably damaging 0.98
R7945:Dhx34 UTSW 7 16210523 missense probably damaging 0.98
X0020:Dhx34 UTSW 7 16205992 missense probably benign 0.32
Z1176:Dhx34 UTSW 7 16218644 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTTCCTGAGCAAGGTGATGGTAG -3'
(R):5'- GGAGTCTGATGAATCTGATGCCCTG -3'

Sequencing Primer
(F):5'- ctctccccctccccctc -3'
(R):5'- ATGAATCTGATGCCCTGTAGTC -3'
Posted On2013-06-12