Incidental Mutation 'R5994:A2m'
ID 481000
Institutional Source Beutler Lab
Gene Symbol A2m
Ensembl Gene ENSMUSG00000030111
Gene Name alpha-2-macroglobulin
Synonyms A2mp
MMRRC Submission 044173-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5994 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 121612920-121656197 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 121647862 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 1118 (H1118L)
Ref Sequence ENSEMBL: ENSMUSP00000032203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032203]
AlphaFold Q6GQT1
Predicted Effect probably benign
Transcript: ENSMUST00000032203
AA Change: H1118L

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000032203
Gene: ENSMUSG00000030111
AA Change: H1118L

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:A2M_N 134 227 2.1e-20 PFAM
low complexity region 334 347 N/A INTRINSIC
A2M_N_2 465 613 2.04e-31 SMART
low complexity region 722 731 N/A INTRINSIC
A2M 738 828 2.31e-39 SMART
Pfam:Thiol-ester_cl 961 990 4.4e-18 PFAM
Pfam:A2M_comp 1010 1266 1.4e-98 PFAM
A2M_recep 1376 1463 2.69e-40 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protease inhibitor and cytokine transporter. It uses a bait-and-trap mechanism to inhibit a broad spectrum of proteases, including trypsin, thrombin and collagenase. It can also inhibit inflammatory cytokines, and it thus disrupts inflammatory cascades. Mutations in this gene are a cause of alpha-2-macroglobulin deficiency. This gene is implicated in Alzheimer's disease (AD) due to its ability to mediate the clearance and degradation of A-beta, the major component of beta-amyloid deposits. A related pseudogene, which is also located on the p arm of chromosome 12, has been identified. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,840,592 (GRCm39) probably null Het
Abcb5 A T 12: 118,928,995 (GRCm39) probably null Het
Adcy6 A T 15: 98,491,545 (GRCm39) I1016N probably damaging Het
Afg3l2 A T 18: 67,562,140 (GRCm39) C312S probably damaging Het
Ano8 C T 8: 71,937,478 (GRCm39) V89M probably damaging Het
Arhgap21 C T 2: 20,886,187 (GRCm39) G330D possibly damaging Het
Caskin1 T C 17: 24,715,935 (GRCm39) L195P probably damaging Het
Cfap54 A G 10: 92,874,943 (GRCm39) I514T probably damaging Het
Ctdsp2 G A 10: 126,831,689 (GRCm39) probably benign Het
Cyp4x1 T C 4: 114,979,142 (GRCm39) I152V probably benign Het
Dglucy G A 12: 100,808,959 (GRCm39) R219Q probably benign Het
Disp3 G T 4: 148,338,741 (GRCm39) A810E possibly damaging Het
Dtx4 T C 19: 12,478,517 (GRCm39) Y22C probably damaging Het
Edaradd A T 13: 12,493,377 (GRCm39) I105N probably damaging Het
Eepd1 C T 9: 25,514,749 (GRCm39) P519S probably damaging Het
Fscn3 A T 6: 28,430,294 (GRCm39) S155C probably benign Het
Gm10134 A T 2: 28,396,258 (GRCm39) E51V probably damaging Het
Gm7247 C T 14: 51,601,805 (GRCm39) S26F probably benign Het
Golga7 T C 8: 23,740,281 (GRCm39) E83G probably benign Het
Gpr12 T C 5: 146,520,241 (GRCm39) H227R probably damaging Het
Hoxa2 T G 6: 52,141,372 (GRCm39) S85R possibly damaging Het
Hrnr T C 3: 93,239,607 (GRCm39) S3282P unknown Het
Ift74 C A 4: 94,579,961 (GRCm39) T543K possibly damaging Het
Klf10 C A 15: 38,296,285 (GRCm39) R420L probably damaging Het
Krt77 T A 15: 101,771,290 (GRCm39) I338F probably damaging Het
Limch1 A T 5: 67,131,965 (GRCm39) S152C probably damaging Het
Mgat4e T A 1: 134,469,234 (GRCm39) H270L probably benign Het
Myrf A T 19: 10,196,481 (GRCm39) L504Q probably null Het
Nckipsd A G 9: 108,691,176 (GRCm39) Q366R probably benign Het
Npy5r A T 8: 67,134,751 (GRCm39) V14D probably benign Het
Nrap T A 19: 56,340,031 (GRCm39) R830* probably null Het
Ogfrl1 A T 1: 23,418,070 (GRCm39) Y103N probably damaging Het
Or10g7 A T 9: 39,905,519 (GRCm39) R138* probably null Het
P2rx4 T A 5: 122,863,142 (GRCm39) L232H probably damaging Het
Pabpc2 A T 18: 39,906,947 (GRCm39) T71S probably benign Het
Paip2b C A 6: 83,785,867 (GRCm39) S121I probably damaging Het
Pofut1 C T 2: 153,103,149 (GRCm39) T261I possibly damaging Het
Ppp6c G T 2: 39,101,004 (GRCm39) T46K possibly damaging Het
Prkd2 C A 7: 16,584,261 (GRCm39) H371Q probably benign Het
Prrc2c A T 1: 162,501,725 (GRCm39) probably null Het
Psd3 C T 8: 68,172,620 (GRCm39) A894T probably damaging Het
Pygm A T 19: 6,448,073 (GRCm39) probably null Het
Pzp A T 6: 128,468,560 (GRCm39) M989K probably damaging Het
Ralgapa2 A T 2: 146,203,373 (GRCm39) S1159T probably benign Het
Rapgefl1 T C 11: 98,740,986 (GRCm39) F575L probably benign Het
Rassf6 A G 5: 90,765,627 (GRCm39) L28S probably damaging Het
Rbp3 G T 14: 33,676,857 (GRCm39) K268N probably damaging Het
Rela C T 19: 5,697,092 (GRCm39) T433M possibly damaging Het
Rnf103 T A 6: 71,473,894 (GRCm39) S102R probably damaging Het
Scarf2 A G 16: 17,624,243 (GRCm39) N516S probably damaging Het
Sdcbp2 T C 2: 151,429,403 (GRCm39) I241T probably damaging Het
Septin7 T C 9: 25,199,494 (GRCm39) I131T possibly damaging Het
Sh3pxd2b T C 11: 32,357,570 (GRCm39) F191L probably damaging Het
Siglec15 C A 18: 78,090,590 (GRCm39) C236F probably damaging Het
Slc11a2 T C 15: 100,295,562 (GRCm39) T520A probably benign Het
Slc26a11 C A 11: 119,270,738 (GRCm39) F553L probably benign Het
Smchd1 G A 17: 71,672,404 (GRCm39) P1596S possibly damaging Het
Taar7b A G 10: 23,876,246 (GRCm39) H137R probably damaging Het
Thap12 T A 7: 98,365,237 (GRCm39) C468* probably null Het
Timp4 C T 6: 115,224,315 (GRCm39) G118D probably damaging Het
Tnnt3 A G 7: 142,065,003 (GRCm39) K48E probably damaging Het
Trmt10a T A 3: 137,862,475 (GRCm39) I255N probably damaging Het
Ttll10 T C 4: 156,133,189 (GRCm39) probably null Het
Tut7 T G 13: 59,937,023 (GRCm39) Y806S probably damaging Het
Ube4b A G 4: 149,457,389 (GRCm39) Y283H probably damaging Het
Ucp1 G T 8: 84,020,567 (GRCm39) V126L possibly damaging Het
Unc13b T A 4: 43,172,596 (GRCm39) probably benign Het
Vps13b T C 15: 35,875,918 (GRCm39) S2768P probably damaging Het
Zfp101 T A 17: 33,599,936 (GRCm39) M607L probably benign Het
Zfp292 C T 4: 34,805,464 (GRCm39) V2527M possibly damaging Het
Zfp503 T A 14: 22,035,630 (GRCm39) T429S possibly damaging Het
Other mutations in A2m
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:A2m APN 6 121,621,108 (GRCm39) missense possibly damaging 0.67
IGL00798:A2m APN 6 121,647,969 (GRCm39) missense probably damaging 1.00
IGL01154:A2m APN 6 121,650,501 (GRCm39) nonsense probably null
IGL01313:A2m APN 6 121,621,969 (GRCm39) critical splice donor site probably null
IGL01337:A2m APN 6 121,645,529 (GRCm39) missense probably damaging 0.98
IGL01505:A2m APN 6 121,653,906 (GRCm39) missense possibly damaging 0.83
IGL01508:A2m APN 6 121,636,326 (GRCm39) nonsense probably null
IGL01672:A2m APN 6 121,618,316 (GRCm39) missense probably damaging 1.00
IGL01951:A2m APN 6 121,644,149 (GRCm39) missense possibly damaging 0.78
IGL02012:A2m APN 6 121,651,820 (GRCm39) missense probably damaging 1.00
IGL02066:A2m APN 6 121,626,854 (GRCm39) missense probably damaging 1.00
IGL02234:A2m APN 6 121,645,179 (GRCm39) missense possibly damaging 0.67
IGL02397:A2m APN 6 121,623,834 (GRCm39) missense probably benign
IGL02407:A2m APN 6 121,645,575 (GRCm39) nonsense probably null
IGL02408:A2m APN 6 121,621,130 (GRCm39) missense probably damaging 0.99
IGL02469:A2m APN 6 121,645,074 (GRCm39) missense probably damaging 1.00
IGL02527:A2m APN 6 121,638,392 (GRCm39) missense probably damaging 0.99
IGL02612:A2m APN 6 121,654,971 (GRCm39) missense probably benign
IGL02746:A2m APN 6 121,646,462 (GRCm39) splice site probably benign
IGL02952:A2m APN 6 121,654,984 (GRCm39) missense probably damaging 0.99
IGL03056:A2m APN 6 121,647,862 (GRCm39) missense probably damaging 0.96
IGL03121:A2m APN 6 121,618,265 (GRCm39) missense probably benign 0.02
IGL03303:A2m APN 6 121,644,122 (GRCm39) missense probably damaging 1.00
IGL03369:A2m APN 6 121,653,862 (GRCm39) critical splice acceptor site probably null
IGL03046:A2m UTSW 6 121,636,282 (GRCm39) missense probably benign 0.04
R0040:A2m UTSW 6 121,622,165 (GRCm39) missense possibly damaging 0.93
R0049:A2m UTSW 6 121,615,267 (GRCm39) missense possibly damaging 0.77
R0049:A2m UTSW 6 121,615,267 (GRCm39) missense possibly damaging 0.77
R0109:A2m UTSW 6 121,636,262 (GRCm39) missense probably benign 0.00
R0147:A2m UTSW 6 121,639,405 (GRCm39) critical splice donor site probably null
R0148:A2m UTSW 6 121,639,405 (GRCm39) critical splice donor site probably null
R0345:A2m UTSW 6 121,615,231 (GRCm39) splice site probably benign
R0445:A2m UTSW 6 121,634,914 (GRCm39) missense probably damaging 1.00
R0766:A2m UTSW 6 121,653,849 (GRCm39) splice site probably benign
R1186:A2m UTSW 6 121,638,493 (GRCm39) missense probably benign 0.00
R1436:A2m UTSW 6 121,621,172 (GRCm39) missense probably benign 0.09
R1452:A2m UTSW 6 121,655,015 (GRCm39) missense probably benign 0.01
R1636:A2m UTSW 6 121,631,571 (GRCm39) missense probably benign 0.04
R1637:A2m UTSW 6 121,631,571 (GRCm39) missense probably benign 0.04
R1638:A2m UTSW 6 121,631,571 (GRCm39) missense probably benign 0.04
R1698:A2m UTSW 6 121,622,117 (GRCm39) missense possibly damaging 0.88
R1776:A2m UTSW 6 121,618,383 (GRCm39) missense probably damaging 1.00
R1791:A2m UTSW 6 121,631,571 (GRCm39) missense probably benign 0.04
R1918:A2m UTSW 6 121,621,895 (GRCm39) missense probably benign 0.16
R1921:A2m UTSW 6 121,631,571 (GRCm39) missense probably benign 0.04
R1927:A2m UTSW 6 121,613,338 (GRCm39) missense probably damaging 1.00
R1934:A2m UTSW 6 121,626,792 (GRCm39) missense probably damaging 0.98
R1943:A2m UTSW 6 121,645,506 (GRCm39) missense possibly damaging 0.90
R1996:A2m UTSW 6 121,646,556 (GRCm39) missense probably damaging 1.00
R2039:A2m UTSW 6 121,636,908 (GRCm39) missense probably benign 0.32
R2085:A2m UTSW 6 121,653,918 (GRCm39) missense probably damaging 1.00
R2092:A2m UTSW 6 121,651,896 (GRCm39) nonsense probably null
R2105:A2m UTSW 6 121,650,459 (GRCm39) missense probably benign 0.04
R2107:A2m UTSW 6 121,631,571 (GRCm39) missense probably benign 0.04
R2235:A2m UTSW 6 121,619,023 (GRCm39) missense probably benign 0.21
R2292:A2m UTSW 6 121,650,518 (GRCm39) missense possibly damaging 0.90
R2350:A2m UTSW 6 121,655,047 (GRCm39) splice site probably benign
R3001:A2m UTSW 6 121,638,406 (GRCm39) missense possibly damaging 0.88
R3002:A2m UTSW 6 121,638,406 (GRCm39) missense possibly damaging 0.88
R3023:A2m UTSW 6 121,646,531 (GRCm39) missense probably benign 0.08
R3429:A2m UTSW 6 121,613,249 (GRCm39) start codon destroyed probably null
R3437:A2m UTSW 6 121,616,253 (GRCm39) missense probably null 0.03
R3909:A2m UTSW 6 121,625,125 (GRCm39) missense probably damaging 1.00
R4300:A2m UTSW 6 121,650,434 (GRCm39) missense probably benign 0.00
R4332:A2m UTSW 6 121,634,406 (GRCm39) missense probably benign 0.01
R4584:A2m UTSW 6 121,634,365 (GRCm39) missense probably benign 0.07
R4697:A2m UTSW 6 121,615,243 (GRCm39) start codon destroyed probably null 0.94
R4710:A2m UTSW 6 121,618,262 (GRCm39) missense probably benign 0.03
R4841:A2m UTSW 6 121,623,803 (GRCm39) missense probably benign 0.06
R5206:A2m UTSW 6 121,651,766 (GRCm39) missense probably damaging 1.00
R5219:A2m UTSW 6 121,653,909 (GRCm39) missense possibly damaging 0.90
R5230:A2m UTSW 6 121,651,820 (GRCm39) missense probably damaging 1.00
R5330:A2m UTSW 6 121,615,375 (GRCm39) missense probably benign 0.11
R5331:A2m UTSW 6 121,615,375 (GRCm39) missense probably benign 0.11
R5377:A2m UTSW 6 121,622,212 (GRCm39) missense probably benign
R5590:A2m UTSW 6 121,653,891 (GRCm39) missense probably damaging 1.00
R5835:A2m UTSW 6 121,616,295 (GRCm39) missense probably damaging 1.00
R5910:A2m UTSW 6 121,645,076 (GRCm39) missense probably damaging 1.00
R5915:A2m UTSW 6 121,644,122 (GRCm39) missense probably damaging 1.00
R5949:A2m UTSW 6 121,655,032 (GRCm39) missense probably damaging 1.00
R5996:A2m UTSW 6 121,636,353 (GRCm39) missense probably damaging 1.00
R6035:A2m UTSW 6 121,615,353 (GRCm39) missense probably damaging 0.99
R6035:A2m UTSW 6 121,615,353 (GRCm39) missense probably damaging 0.99
R6090:A2m UTSW 6 121,624,972 (GRCm39) missense probably benign 0.45
R6241:A2m UTSW 6 121,623,788 (GRCm39) missense probably benign 0.09
R6294:A2m UTSW 6 121,631,440 (GRCm39) missense probably benign
R6492:A2m UTSW 6 121,631,464 (GRCm39) missense probably benign 0.35
R6554:A2m UTSW 6 121,618,246 (GRCm39) missense probably damaging 1.00
R6597:A2m UTSW 6 121,625,080 (GRCm39) missense probably damaging 1.00
R6742:A2m UTSW 6 121,654,995 (GRCm39) missense probably benign 0.01
R6795:A2m UTSW 6 121,625,281 (GRCm39) splice site probably null
R6843:A2m UTSW 6 121,615,360 (GRCm39) missense probably benign 0.01
R7013:A2m UTSW 6 121,618,345 (GRCm39) missense probably null 0.00
R7137:A2m UTSW 6 121,654,944 (GRCm39) missense possibly damaging 0.85
R7167:A2m UTSW 6 121,624,930 (GRCm39) missense probably benign
R7294:A2m UTSW 6 121,650,541 (GRCm39) nonsense probably null
R7452:A2m UTSW 6 121,618,291 (GRCm39) missense probably damaging 1.00
R7507:A2m UTSW 6 121,652,177 (GRCm39) missense probably benign 0.01
R7602:A2m UTSW 6 121,647,895 (GRCm39) missense possibly damaging 0.79
R7602:A2m UTSW 6 121,618,966 (GRCm39) missense probably damaging 1.00
R7709:A2m UTSW 6 121,637,063 (GRCm39) missense possibly damaging 0.81
R7766:A2m UTSW 6 121,615,300 (GRCm39) missense probably benign 0.08
R7921:A2m UTSW 6 121,654,954 (GRCm39) missense probably benign 0.00
R8007:A2m UTSW 6 121,647,845 (GRCm39) intron probably benign
R8291:A2m UTSW 6 121,655,017 (GRCm39) missense probably damaging 1.00
R8542:A2m UTSW 6 121,634,369 (GRCm39) missense probably benign 0.03
R8856:A2m UTSW 6 121,618,349 (GRCm39) missense probably benign 0.00
R9023:A2m UTSW 6 121,636,917 (GRCm39) missense possibly damaging 0.90
R9154:A2m UTSW 6 121,645,512 (GRCm39) missense probably damaging 1.00
R9156:A2m UTSW 6 121,647,957 (GRCm39) missense probably damaging 0.98
R9255:A2m UTSW 6 121,626,795 (GRCm39) missense probably damaging 1.00
R9269:A2m UTSW 6 121,637,865 (GRCm39) missense probably benign 0.38
R9325:A2m UTSW 6 121,646,578 (GRCm39) missense possibly damaging 0.81
R9393:A2m UTSW 6 121,616,270 (GRCm39) missense possibly damaging 0.91
R9563:A2m UTSW 6 121,645,009 (GRCm39) missense probably damaging 0.99
X0057:A2m UTSW 6 121,645,135 (GRCm39) missense probably damaging 1.00
X0060:A2m UTSW 6 121,653,039 (GRCm39) missense probably damaging 1.00
X0063:A2m UTSW 6 121,623,835 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGGATCCTAAAGACATGGCTAATG -3'
(R):5'- CGCCTCCTCATCGAGTGATT -3'

Sequencing Primer
(F):5'- CAAAGTCCAGTTAGTGCTGC -3'
(R):5'- TCCTCATCGAGTGATTTCAGTATC -3'
Posted On 2017-06-26