Mutagenetix > Incidental Mutation

Incidental Mutation 'R5994:A2m'

481000

Institutional Source

Beutler Lab

Gene Symbol

A2m

Ensembl Gene

ENSMUSG00000030111

Gene Name

alpha-2-macroglobulin

Synonyms

A2mp

MMRRC Submission

044173-MU

Accession Numbers

NCBI RefSeq: NM_175628.3; MGI:2449119

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5994 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

121635376-121679227 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 121670903 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 1118 (H1118L)

Ref Sequence

ENSEMBL: ENSMUSP00000032203 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032203]

AlphaFold

Q6GQT1

Predicted Effect

probably benign
Transcript: ENSMUST00000032203
AA Change: H1118L

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000032203
Gene: ENSMUSG00000030111
AA Change: H1118L

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Pfam:A2M_N	134	227	2.1e-20	PFAM
low complexity region	334	347	N/A	INTRINSIC
A2M_N_2	465	613	2.04e-31	SMART
low complexity region	722	731	N/A	INTRINSIC
A2M	738	828	2.31e-39	SMART
Pfam:Thiol-ester_cl	961	990	4.4e-18	PFAM
Pfam:A2M_comp	1010	1266	1.4e-98	PFAM
A2M_recep	1376	1463	2.69e-40	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 91.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protease inhibitor and cytokine transporter. It uses a bait-and-trap mechanism to inhibit a broad spectrum of proteases, including trypsin, thrombin and collagenase. It can also inhibit inflammatory cytokines, and it thus disrupts inflammatory cascades. Mutations in this gene are a cause of alpha-2-macroglobulin deficiency. This gene is implicated in Alzheimer's disease (AD) due to its ability to mediate the clearance and degradation of A-beta, the major component of beta-amyloid deposits. A related pseudogene, which is also located on the p arm of chromosome 12, has been identified. [provided by RefSeq, Nov 2016]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	A	G	11: 109,949,766		probably null	Het
Abcb5	A	T	12: 118,965,260		probably null	Het
Adcy6	A	T	15: 98,593,664	I1016N	probably damaging	Het
Afg3l2	A	T	18: 67,429,070	C312S	probably damaging	Het
Ano8	C	T	8: 71,484,834	V89M	probably damaging	Het
Arhgap21	C	T	2: 20,881,376	G330D	possibly damaging	Het
Caskin1	T	C	17: 24,496,961	L195P	probably damaging	Het
Cfap54	A	G	10: 93,039,081	I514T	probably damaging	Het
Ctdsp2	G	A	10: 126,995,820		probably benign	Het
Cyp4x1	T	C	4: 115,121,945	I152V	probably benign	Het
Dglucy	G	A	12: 100,842,700	R219Q	probably benign	Het
Disp3	G	T	4: 148,254,284	A810E	possibly damaging	Het
Dtx4	T	C	19: 12,501,153	Y22C	probably damaging	Het
Edaradd	A	T	13: 12,478,496	I105N	probably damaging	Het
Eepd1	C	T	9: 25,603,453	P519S	probably damaging	Het
Fscn3	A	T	6: 28,430,295	S155C	probably benign	Het
Gm10134	A	T	2: 28,506,246	E51V	probably damaging	Het
Gm7247	C	T	14: 51,364,348	S26F	probably benign	Het
Golga7	T	C	8: 23,250,265	E83G	probably benign	Het
Gpr12	T	C	5: 146,583,431	H227R	probably damaging	Het
Hoxa2	T	G	6: 52,164,392	S85R	possibly damaging	Het
Hrnr	T	C	3: 93,332,300	S3282P	unknown	Het
Ift74	C	A	4: 94,691,724	T543K	possibly damaging	Het
Klf10	C	A	15: 38,296,041	R420L	probably damaging	Het
Krt77	T	A	15: 101,862,855	I338F	probably damaging	Het
Limch1	A	T	5: 66,974,622	S152C	probably damaging	Het
Mgat4e	T	A	1: 134,541,496	H270L	probably benign	Het
Myrf	A	T	19: 10,219,117	L504Q	probably null	Het
Nckipsd	A	G	9: 108,813,977	Q366R	probably benign	Het
Npy5r	A	T	8: 66,682,099	V14D	probably benign	Het
Nrap	T	A	19: 56,351,599	R830*	probably null	Het
Ogfrl1	A	T	1: 23,378,989	Y103N	probably damaging	Het
Olfr978	A	T	9: 39,994,223	R138*	probably null	Het
P2rx4	T	A	5: 122,725,079	L232H	probably damaging	Het
Pabpc2	A	T	18: 39,773,894	T71S	probably benign	Het
Paip2b	C	A	6: 83,808,885	S121I	probably damaging	Het
Pofut1	C	T	2: 153,261,229	T261I	possibly damaging	Het
Ppp6c	G	T	2: 39,210,992	T46K	possibly damaging	Het
Prkd2	C	A	7: 16,850,336	H371Q	probably benign	Het
Prrc2c	A	T	1: 162,674,156		probably null	Het
Psd3	C	T	8: 67,719,968	A894T	probably damaging	Het
Pygm	A	T	19: 6,398,043		probably null	Het
Pzp	A	T	6: 128,491,597	M989K	probably damaging	Het
Ralgapa2	A	T	2: 146,361,453	S1159T	probably benign	Het
Rapgefl1	T	C	11: 98,850,160	F575L	probably benign	Het
Rassf6	A	G	5: 90,617,768	L28S	probably damaging	Het
Rbp3	G	T	14: 33,954,900	K268N	probably damaging	Het
Rela	C	T	19: 5,647,064	T433M	possibly damaging	Het
Rnf103	T	A	6: 71,496,910	S102R	probably damaging	Het
Scarf2	A	G	16: 17,806,379	N516S	probably damaging	Het
Sdcbp2	T	C	2: 151,587,483	I241T	probably damaging	Het
Sept7	T	C	9: 25,288,198	I131T	possibly damaging	Het
Sh3pxd2b	T	C	11: 32,407,570	F191L	probably damaging	Het
Siglec15	C	A	18: 78,047,375	C236F	probably damaging	Het
Slc11a2	T	C	15: 100,397,681	T520A	probably benign	Het
Slc26a11	C	A	11: 119,379,912	F553L	probably benign	Het
Smchd1	G	A	17: 71,365,409	P1596S	possibly damaging	Het
Taar7b	A	G	10: 24,000,348	H137R	probably damaging	Het
Thap12	T	A	7: 98,716,030	C468*	probably null	Het
Timp4	C	T	6: 115,247,354	G118D	probably damaging	Het
Tnnt3	A	G	7: 142,511,266	K48E	probably damaging	Het
Trmt10a	T	A	3: 138,156,714	I255N	probably damaging	Het
Ttll10	T	C	4: 156,048,732		probably null	Het
Ube4b	A	G	4: 149,372,932	Y283H	probably damaging	Het
Ucp1	G	T	8: 83,293,938	V126L	possibly damaging	Het
Unc13b	T	A	4: 43,172,596		probably benign	Het
Vps13b	T	C	15: 35,875,772	S2768P	probably damaging	Het
Zcchc6	T	G	13: 59,789,209	Y806S	probably damaging	Het
Zfp101	T	A	17: 33,380,962	M607L	probably benign	Het
Zfp292	C	T	4: 34,805,464	V2527M	possibly damaging	Het
Zfp503	T	A	14: 21,985,562	T429S	possibly damaging	Het

Other mutations in A2m

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00494:A2m	APN	6	121644149	missense	possibly damaging	0.67
IGL00798:A2m	APN	6	121671010	missense	probably damaging	1.00
IGL01154:A2m	APN	6	121673542	nonsense	probably null
IGL01313:A2m	APN	6	121645010	critical splice donor site	probably null
IGL01337:A2m	APN	6	121668570	missense	probably damaging	0.98
IGL01505:A2m	APN	6	121676947	missense	possibly damaging	0.83
IGL01508:A2m	APN	6	121659367	nonsense	probably null
IGL01672:A2m	APN	6	121641357	missense	probably damaging	1.00
IGL01951:A2m	APN	6	121667190	missense	possibly damaging	0.78
IGL02012:A2m	APN	6	121674861	missense	probably damaging	1.00
IGL02066:A2m	APN	6	121649895	missense	probably damaging	1.00
IGL02234:A2m	APN	6	121668220	missense	possibly damaging	0.67
IGL02397:A2m	APN	6	121646875	missense	probably benign
IGL02407:A2m	APN	6	121668616	nonsense	probably null
IGL02408:A2m	APN	6	121644171	missense	probably damaging	0.99
IGL02469:A2m	APN	6	121668115	missense	probably damaging	1.00
IGL02527:A2m	APN	6	121661433	missense	probably damaging	0.99
IGL02612:A2m	APN	6	121678012	missense	probably benign
IGL02746:A2m	APN	6	121669503	splice site	probably benign
IGL02952:A2m	APN	6	121678025	missense	probably damaging	0.99
IGL03056:A2m	APN	6	121670903	missense	probably damaging	0.96
IGL03121:A2m	APN	6	121641306	missense	probably benign	0.02
IGL03303:A2m	APN	6	121667163	missense	probably damaging	1.00
IGL03369:A2m	APN	6	121676903	critical splice acceptor site	probably null
IGL03046:A2m	UTSW	6	121659323	missense	probably benign	0.04
R0040:A2m	UTSW	6	121645206	missense	possibly damaging	0.93
R0049:A2m	UTSW	6	121638308	missense	possibly damaging	0.77
R0049:A2m	UTSW	6	121638308	missense	possibly damaging	0.77
R0109:A2m	UTSW	6	121659303	missense	probably benign	0.00
R0147:A2m	UTSW	6	121662446	critical splice donor site	probably null
R0148:A2m	UTSW	6	121662446	critical splice donor site	probably null
R0345:A2m	UTSW	6	121638272	splice site	probably benign
R0445:A2m	UTSW	6	121657955	missense	probably damaging	1.00
R0766:A2m	UTSW	6	121676890	splice site	probably benign
R1186:A2m	UTSW	6	121661534	missense	probably benign	0.00
R1436:A2m	UTSW	6	121644213	missense	probably benign	0.09
R1452:A2m	UTSW	6	121678056	missense	probably benign	0.01
R1636:A2m	UTSW	6	121654612	missense	probably benign	0.04
R1637:A2m	UTSW	6	121654612	missense	probably benign	0.04
R1638:A2m	UTSW	6	121654612	missense	probably benign	0.04
R1698:A2m	UTSW	6	121645158	missense	possibly damaging	0.88
R1776:A2m	UTSW	6	121641424	missense	probably damaging	1.00
R1791:A2m	UTSW	6	121654612	missense	probably benign	0.04
R1918:A2m	UTSW	6	121644936	missense	probably benign	0.16
R1921:A2m	UTSW	6	121654612	missense	probably benign	0.04
R1927:A2m	UTSW	6	121636379	missense	probably damaging	1.00
R1934:A2m	UTSW	6	121649833	missense	probably damaging	0.98
R1943:A2m	UTSW	6	121668547	missense	possibly damaging	0.90
R1996:A2m	UTSW	6	121669597	missense	probably damaging	1.00
R2039:A2m	UTSW	6	121659949	missense	probably benign	0.32
R2085:A2m	UTSW	6	121676959	missense	probably damaging	1.00
R2092:A2m	UTSW	6	121674937	nonsense	probably null
R2105:A2m	UTSW	6	121673500	missense	probably benign	0.04
R2107:A2m	UTSW	6	121654612	missense	probably benign	0.04
R2235:A2m	UTSW	6	121642064	missense	probably benign	0.21
R2292:A2m	UTSW	6	121673559	missense	possibly damaging	0.90
R2350:A2m	UTSW	6	121678088	splice site	probably benign
R3001:A2m	UTSW	6	121661447	missense	possibly damaging	0.88
R3002:A2m	UTSW	6	121661447	missense	possibly damaging	0.88
R3023:A2m	UTSW	6	121669572	missense	probably benign	0.08
R3429:A2m	UTSW	6	121636290	start codon destroyed	probably null
R3437:A2m	UTSW	6	121639294	missense	probably null	0.03
R3909:A2m	UTSW	6	121648166	missense	probably damaging	1.00
R4300:A2m	UTSW	6	121673475	missense	probably benign	0.00
R4332:A2m	UTSW	6	121657447	missense	probably benign	0.01
R4584:A2m	UTSW	6	121657406	missense	probably benign	0.07
R4697:A2m	UTSW	6	121638284	start codon destroyed	probably null	0.94
R4710:A2m	UTSW	6	121641303	missense	probably benign	0.03
R4841:A2m	UTSW	6	121646844	missense	probably benign	0.06
R5206:A2m	UTSW	6	121674807	missense	probably damaging	1.00
R5219:A2m	UTSW	6	121676950	missense	possibly damaging	0.90
R5230:A2m	UTSW	6	121674861	missense	probably damaging	1.00
R5330:A2m	UTSW	6	121638416	missense	probably benign	0.11
R5331:A2m	UTSW	6	121638416	missense	probably benign	0.11
R5377:A2m	UTSW	6	121645253	missense	probably benign
R5590:A2m	UTSW	6	121676932	missense	probably damaging	1.00
R5835:A2m	UTSW	6	121639336	missense	probably damaging	1.00
R5910:A2m	UTSW	6	121668117	missense	probably damaging	1.00
R5915:A2m	UTSW	6	121667163	missense	probably damaging	1.00
R5949:A2m	UTSW	6	121678073	missense	probably damaging	1.00
R5996:A2m	UTSW	6	121659394	missense	probably damaging	1.00
R6035:A2m	UTSW	6	121638394	missense	probably damaging	0.99
R6035:A2m	UTSW	6	121638394	missense	probably damaging	0.99
R6090:A2m	UTSW	6	121648013	missense	probably benign	0.45
R6241:A2m	UTSW	6	121646829	missense	probably benign	0.09
R6294:A2m	UTSW	6	121654481	missense	probably benign
R6492:A2m	UTSW	6	121654505	missense	probably benign	0.35
R6554:A2m	UTSW	6	121641287	missense	probably damaging	1.00
R6597:A2m	UTSW	6	121648121	missense	probably damaging	1.00
R6742:A2m	UTSW	6	121678036	missense	probably benign	0.01
R6795:A2m	UTSW	6	121648322	splice site	probably null
R6843:A2m	UTSW	6	121638401	missense	probably benign	0.01
R7013:A2m	UTSW	6	121641386	missense	probably null	0.00
R7137:A2m	UTSW	6	121677985	missense	possibly damaging	0.85
R7167:A2m	UTSW	6	121647971	missense	probably benign
R7294:A2m	UTSW	6	121673582	nonsense	probably null
R7452:A2m	UTSW	6	121641332	missense	probably damaging	1.00
R7507:A2m	UTSW	6	121675218	missense	probably benign	0.01
R7602:A2m	UTSW	6	121642007	missense	probably damaging	1.00
R7602:A2m	UTSW	6	121670936	missense	possibly damaging	0.79
R7709:A2m	UTSW	6	121660104	missense	possibly damaging	0.81
R7766:A2m	UTSW	6	121638341	missense	probably benign	0.08
R7921:A2m	UTSW	6	121677995	missense	probably benign	0.00
R8007:A2m	UTSW	6	121670886	intron	probably benign
R8291:A2m	UTSW	6	121678058	missense	probably damaging	1.00
R8542:A2m	UTSW	6	121657410	missense	probably benign	0.03
R8856:A2m	UTSW	6	121641390	missense	probably benign	0.00
R9023:A2m	UTSW	6	121659958	missense	possibly damaging	0.90
R9154:A2m	UTSW	6	121668553	missense	probably damaging	1.00
R9156:A2m	UTSW	6	121670998	missense	probably damaging	0.98
R9255:A2m	UTSW	6	121649836	missense	probably damaging	1.00
R9269:A2m	UTSW	6	121660906	missense	probably benign	0.38
R9325:A2m	UTSW	6	121669619	missense	possibly damaging	0.81
R9393:A2m	UTSW	6	121639311	missense	possibly damaging	0.91
R9563:A2m	UTSW	6	121668050	missense	probably damaging	0.99
X0057:A2m	UTSW	6	121668176	missense	probably damaging	1.00
X0060:A2m	UTSW	6	121676080	missense	probably damaging	1.00
X0063:A2m	UTSW	6	121646876	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AAGGATCCTAAAGACATGGCTAATG -3'
(R):5'- CGCCTCCTCATCGAGTGATT -3'

Sequencing Primer
(F):5'- CAAAGTCCAGTTAGTGCTGC -3'
(R):5'- TCCTCATCGAGTGATTTCAGTATC -3'

Posted On

2017-06-26