Incidental Mutation 'R5994:Pzp'
ID481001
Institutional Source Beutler Lab
Gene Symbol Pzp
Ensembl Gene ENSMUSG00000030359
Gene NamePZP, alpha-2-macroglobulin like
Synonyms
MMRRC Submission 044173-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R5994 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location128483567-128526720 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 128491597 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 989 (M989K)
Ref Sequence ENSEMBL: ENSMUSP00000107760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112132]
Predicted Effect probably damaging
Transcript: ENSMUST00000112132
AA Change: M989K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107760
Gene: ENSMUSG00000030359
AA Change: M989K

DomainStartEndE-ValueType
low complexity region 11 18 N/A INTRINSIC
Pfam:A2M_N 126 219 3.2e-23 PFAM
low complexity region 327 338 N/A INTRINSIC
A2M_N_2 458 606 6.18e-40 SMART
A2M 750 840 2.27e-38 SMART
Pfam:Thiol-ester_cl 973 1003 4e-19 PFAM
Pfam:A2M_comp 1022 1284 2.1e-90 PFAM
A2M_recep 1395 1482 6.47e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203753
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204291
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes mutant null mice show higher bone mineral density, hypoactivity, and decreased heart rate. Mice homozygous for a different null allele show resistance to the lethal effects of endotoxin, increased susceptibility to diet-induced acute pancreatitis, and altered LPS-induced febrile and cytokine responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,670,903 H1118L probably benign Het
Abca8b A G 11: 109,949,766 probably null Het
Abcb5 A T 12: 118,965,260 probably null Het
Adcy6 A T 15: 98,593,664 I1016N probably damaging Het
Afg3l2 A T 18: 67,429,070 C312S probably damaging Het
Ano8 C T 8: 71,484,834 V89M probably damaging Het
Arhgap21 C T 2: 20,881,376 G330D possibly damaging Het
Caskin1 T C 17: 24,496,961 L195P probably damaging Het
Cfap54 A G 10: 93,039,081 I514T probably damaging Het
Ctdsp2 G A 10: 126,995,820 probably benign Het
Cyp4x1 T C 4: 115,121,945 I152V probably benign Het
Dglucy G A 12: 100,842,700 R219Q probably benign Het
Disp3 G T 4: 148,254,284 A810E possibly damaging Het
Dtx4 T C 19: 12,501,153 Y22C probably damaging Het
Edaradd A T 13: 12,478,496 I105N probably damaging Het
Eepd1 C T 9: 25,603,453 P519S probably damaging Het
Fscn3 A T 6: 28,430,295 S155C probably benign Het
Gm10134 A T 2: 28,506,246 E51V probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Golga7 T C 8: 23,250,265 E83G probably benign Het
Gpr12 T C 5: 146,583,431 H227R probably damaging Het
Hoxa2 T G 6: 52,164,392 S85R possibly damaging Het
Hrnr T C 3: 93,332,300 S3282P unknown Het
Ift74 C A 4: 94,691,724 T543K possibly damaging Het
Klf10 C A 15: 38,296,041 R420L probably damaging Het
Krt77 T A 15: 101,862,855 I338F probably damaging Het
Limch1 A T 5: 66,974,622 S152C probably damaging Het
Mgat4e T A 1: 134,541,496 H270L probably benign Het
Myrf A T 19: 10,219,117 L504Q probably null Het
Nckipsd A G 9: 108,813,977 Q366R probably benign Het
Npy5r A T 8: 66,682,099 V14D probably benign Het
Nrap T A 19: 56,351,599 R830* probably null Het
Ogfrl1 A T 1: 23,378,989 Y103N probably damaging Het
Olfr978 A T 9: 39,994,223 R138* probably null Het
P2rx4 T A 5: 122,725,079 L232H probably damaging Het
Pabpc2 A T 18: 39,773,894 T71S probably benign Het
Paip2b C A 6: 83,808,885 S121I probably damaging Het
Pofut1 C T 2: 153,261,229 T261I possibly damaging Het
Ppp6c G T 2: 39,210,992 T46K possibly damaging Het
Prkd2 C A 7: 16,850,336 H371Q probably benign Het
Prrc2c A T 1: 162,674,156 probably null Het
Psd3 C T 8: 67,719,968 A894T probably damaging Het
Pygm A T 19: 6,398,043 probably null Het
Ralgapa2 A T 2: 146,361,453 S1159T probably benign Het
Rapgefl1 T C 11: 98,850,160 F575L probably benign Het
Rassf6 A G 5: 90,617,768 L28S probably damaging Het
Rbp3 G T 14: 33,954,900 K268N probably damaging Het
Rela C T 19: 5,647,064 T433M possibly damaging Het
Rnf103 T A 6: 71,496,910 S102R probably damaging Het
Scarf2 A G 16: 17,806,379 N516S probably damaging Het
Sdcbp2 T C 2: 151,587,483 I241T probably damaging Het
Sept7 T C 9: 25,288,198 I131T possibly damaging Het
Sh3pxd2b T C 11: 32,407,570 F191L probably damaging Het
Siglec15 C A 18: 78,047,375 C236F probably damaging Het
Slc11a2 T C 15: 100,397,681 T520A probably benign Het
Slc26a11 C A 11: 119,379,912 F553L probably benign Het
Smchd1 G A 17: 71,365,409 P1596S possibly damaging Het
Taar7b A G 10: 24,000,348 H137R probably damaging Het
Thap12 T A 7: 98,716,030 C468* probably null Het
Timp4 C T 6: 115,247,354 G118D probably damaging Het
Tnnt3 A G 7: 142,511,266 K48E probably damaging Het
Trmt10a T A 3: 138,156,714 I255N probably damaging Het
Ttll10 T C 4: 156,048,732 probably null Het
Ube4b A G 4: 149,372,932 Y283H probably damaging Het
Ucp1 G T 8: 83,293,938 V126L possibly damaging Het
Unc13b T A 4: 43,172,596 probably benign Het
Vps13b T C 15: 35,875,772 S2768P probably damaging Het
Zcchc6 T G 13: 59,789,209 Y806S probably damaging Het
Zfp101 T A 17: 33,380,962 M607L probably benign Het
Zfp292 C T 4: 34,805,464 V2527M possibly damaging Het
Zfp503 T A 14: 21,985,562 T429S possibly damaging Het
Other mutations in Pzp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Pzp APN 6 128516909 missense probably benign 0.25
IGL01470:Pzp APN 6 128521124 missense probably benign 0.05
IGL01753:Pzp APN 6 128502183 missense possibly damaging 0.78
IGL01878:Pzp APN 6 128495298 missense probably damaging 1.00
IGL02307:Pzp APN 6 128489086 nonsense probably null
IGL02338:Pzp APN 6 128486170 missense probably benign 0.07
IGL02546:Pzp APN 6 128494699 splice site probably benign
IGL02598:Pzp APN 6 128487457 missense probably benign 0.00
IGL02699:Pzp APN 6 128487401 critical splice donor site probably null
lilibet UTSW 6 128513773 missense probably damaging 0.99
P4748:Pzp UTSW 6 128490089 missense probably damaging 1.00
PIT4151001:Pzp UTSW 6 128525296 missense probably benign 0.34
PIT4495001:Pzp UTSW 6 128502229 missense probably benign
R0157:Pzp UTSW 6 128523976 nonsense probably null
R0195:Pzp UTSW 6 128487478 missense probably damaging 1.00
R0238:Pzp UTSW 6 128489156 splice site probably benign
R0239:Pzp UTSW 6 128489156 splice site probably benign
R0271:Pzp UTSW 6 128519514 missense probably damaging 1.00
R0299:Pzp UTSW 6 128495330 splice site probably benign
R0744:Pzp UTSW 6 128516195 unclassified probably benign
R0968:Pzp UTSW 6 128525145 missense probably benign 0.00
R1037:Pzp UTSW 6 128519426 missense probably benign 0.01
R1074:Pzp UTSW 6 128487924 missense probably benign 0.20
R1469:Pzp UTSW 6 128512356 missense probably benign 0.04
R1469:Pzp UTSW 6 128512356 missense probably benign 0.04
R1579:Pzp UTSW 6 128523968 critical splice donor site probably null
R1646:Pzp UTSW 6 128503555 missense probably benign 0.33
R1770:Pzp UTSW 6 128485617 missense probably damaging 1.00
R1777:Pzp UTSW 6 128490572 missense possibly damaging 0.85
R1786:Pzp UTSW 6 128491161 splice site probably null
R1854:Pzp UTSW 6 128502225 missense probably damaging 1.00
R2001:Pzp UTSW 6 128516120 missense probably benign 0.01
R2060:Pzp UTSW 6 128483710 missense probably benign 0.45
R2081:Pzp UTSW 6 128519420 missense probably benign 0.00
R2130:Pzp UTSW 6 128491161 splice site probably null
R2131:Pzp UTSW 6 128491161 splice site probably null
R2160:Pzp UTSW 6 128525276 missense probably damaging 1.00
R2168:Pzp UTSW 6 128488047 missense probably damaging 0.98
R2328:Pzp UTSW 6 128510390 missense possibly damaging 0.79
R2441:Pzp UTSW 6 128489768 nonsense probably null
R2866:Pzp UTSW 6 128525264 missense possibly damaging 0.76
R2869:Pzp UTSW 6 128485556 critical splice donor site probably null
R2869:Pzp UTSW 6 128485556 critical splice donor site probably null
R2870:Pzp UTSW 6 128485556 critical splice donor site probably null
R2870:Pzp UTSW 6 128485556 critical splice donor site probably null
R2873:Pzp UTSW 6 128485556 critical splice donor site probably null
R2876:Pzp UTSW 6 128491550 missense probably damaging 1.00
R3404:Pzp UTSW 6 128513806 missense probably damaging 1.00
R4452:Pzp UTSW 6 128491240 missense probably damaging 1.00
R4461:Pzp UTSW 6 128524040 missense probably benign 0.02
R5103:Pzp UTSW 6 128502229 missense probably benign 0.04
R5193:Pzp UTSW 6 128502334 missense probably benign 0.00
R5425:Pzp UTSW 6 128489048 missense probably damaging 0.97
R5465:Pzp UTSW 6 128486961 missense probably damaging 1.00
R5590:Pzp UTSW 6 128523796 missense probably damaging 1.00
R5656:Pzp UTSW 6 128490072 missense probably damaging 0.99
R5697:Pzp UTSW 6 128525189 missense probably benign 0.03
R5854:Pzp UTSW 6 128506869 missense probably benign 0.01
R6042:Pzp UTSW 6 128524014 missense possibly damaging 0.75
R6054:Pzp UTSW 6 128513764 missense probably benign 0.03
R6153:Pzp UTSW 6 128489016 missense probably benign
R6465:Pzp UTSW 6 128491619 missense probably damaging 1.00
R6719:Pzp UTSW 6 128524083 missense probably benign 0.17
R6722:Pzp UTSW 6 128487954 missense probably damaging 1.00
R7316:Pzp UTSW 6 128513773 missense probably damaging 0.99
R7453:Pzp UTSW 6 128486916 missense probably damaging 1.00
R7826:Pzp UTSW 6 128487533 missense probably benign 0.38
R7878:Pzp UTSW 6 128512311 missense possibly damaging 0.50
R7879:Pzp UTSW 6 128489016 missense probably benign
R8113:Pzp UTSW 6 128513731 splice site probably null
R8163:Pzp UTSW 6 128512194 missense probably benign 0.00
R8471:Pzp UTSW 6 128487448 missense probably benign 0.14
R8680:Pzp UTSW 6 128496046 missense probably benign 0.00
R8795:Pzp UTSW 6 128494738 missense probably damaging 1.00
R8844:Pzp UTSW 6 128523987 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGGGTCATTTGATTGGAAATAC -3'
(R):5'- GTCCTGGAGCCATCTGTTTTAC -3'

Sequencing Primer
(F):5'- GGTCATTTGATTGGAAATACAGCAAC -3'
(R):5'- GGAGCCATCTGTTTTACTCATTTC -3'
Posted On2017-06-26