Incidental Mutation 'R5994:Prkd2'
ID 481002
Institutional Source Beutler Lab
Gene Symbol Prkd2
Ensembl Gene ENSMUSG00000041187
Gene Name protein kinase D2
Synonyms PKD2
MMRRC Submission 044173-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5994 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 16576827-16604386 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 16584261 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 371 (H371Q)
Ref Sequence ENSEMBL: ENSMUSP00000131192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086104] [ENSMUST00000168093]
AlphaFold Q8BZ03
Predicted Effect probably benign
Transcript: ENSMUST00000086104
AA Change: H371Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000083273
Gene: ENSMUSG00000041187
AA Change: H371Q

DomainStartEndE-ValueType
low complexity region 2 43 N/A INTRINSIC
C1 139 188 2.87e-11 SMART
C1 266 315 1.28e-17 SMART
low complexity region 353 373 N/A INTRINSIC
PH 399 512 2.07e-6 SMART
S_TKc 552 808 6.12e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168093
AA Change: H371Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000131192
Gene: ENSMUSG00000041187
AA Change: H371Q

DomainStartEndE-ValueType
low complexity region 2 43 N/A INTRINSIC
C1 139 188 2.87e-11 SMART
C1 266 315 1.28e-17 SMART
low complexity region 353 373 N/A INTRINSIC
PH 399 512 2.07e-6 SMART
S_TKc 552 808 6.12e-92 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205456
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205841
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205999
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the protein kinase D (PKD) family of serine/threonine protein kinases. This kinase can be activated by phorbol esters as well as by gastrin via the cholecystokinin B receptor (CCKBR) in gastric cancer cells. It can bind to diacylglycerol (DAG) in the trans-Golgi network (TGN) and may regulate basolateral membrane protein exit from TGN. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired IgM and IgG1 antigen responses and CD4+ and CD8+ T cell production of IL2 and IFN-gamma in response to TCR stimulation. Mice homozygous for a gene trap allele exhibit normal T lymphocyte maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,647,862 (GRCm39) H1118L probably benign Het
Abca8b A G 11: 109,840,592 (GRCm39) probably null Het
Abcb5 A T 12: 118,928,995 (GRCm39) probably null Het
Adcy6 A T 15: 98,491,545 (GRCm39) I1016N probably damaging Het
Afg3l2 A T 18: 67,562,140 (GRCm39) C312S probably damaging Het
Ano8 C T 8: 71,937,478 (GRCm39) V89M probably damaging Het
Arhgap21 C T 2: 20,886,187 (GRCm39) G330D possibly damaging Het
Caskin1 T C 17: 24,715,935 (GRCm39) L195P probably damaging Het
Cfap54 A G 10: 92,874,943 (GRCm39) I514T probably damaging Het
Ctdsp2 G A 10: 126,831,689 (GRCm39) probably benign Het
Cyp4x1 T C 4: 114,979,142 (GRCm39) I152V probably benign Het
Dglucy G A 12: 100,808,959 (GRCm39) R219Q probably benign Het
Disp3 G T 4: 148,338,741 (GRCm39) A810E possibly damaging Het
Dtx4 T C 19: 12,478,517 (GRCm39) Y22C probably damaging Het
Edaradd A T 13: 12,493,377 (GRCm39) I105N probably damaging Het
Eepd1 C T 9: 25,514,749 (GRCm39) P519S probably damaging Het
Fscn3 A T 6: 28,430,294 (GRCm39) S155C probably benign Het
Gm10134 A T 2: 28,396,258 (GRCm39) E51V probably damaging Het
Gm7247 C T 14: 51,601,805 (GRCm39) S26F probably benign Het
Golga7 T C 8: 23,740,281 (GRCm39) E83G probably benign Het
Gpr12 T C 5: 146,520,241 (GRCm39) H227R probably damaging Het
Hoxa2 T G 6: 52,141,372 (GRCm39) S85R possibly damaging Het
Hrnr T C 3: 93,239,607 (GRCm39) S3282P unknown Het
Ift74 C A 4: 94,579,961 (GRCm39) T543K possibly damaging Het
Klf10 C A 15: 38,296,285 (GRCm39) R420L probably damaging Het
Krt77 T A 15: 101,771,290 (GRCm39) I338F probably damaging Het
Limch1 A T 5: 67,131,965 (GRCm39) S152C probably damaging Het
Mgat4e T A 1: 134,469,234 (GRCm39) H270L probably benign Het
Myrf A T 19: 10,196,481 (GRCm39) L504Q probably null Het
Nckipsd A G 9: 108,691,176 (GRCm39) Q366R probably benign Het
Npy5r A T 8: 67,134,751 (GRCm39) V14D probably benign Het
Nrap T A 19: 56,340,031 (GRCm39) R830* probably null Het
Ogfrl1 A T 1: 23,418,070 (GRCm39) Y103N probably damaging Het
Or10g7 A T 9: 39,905,519 (GRCm39) R138* probably null Het
P2rx4 T A 5: 122,863,142 (GRCm39) L232H probably damaging Het
Pabpc2 A T 18: 39,906,947 (GRCm39) T71S probably benign Het
Paip2b C A 6: 83,785,867 (GRCm39) S121I probably damaging Het
Pofut1 C T 2: 153,103,149 (GRCm39) T261I possibly damaging Het
Ppp6c G T 2: 39,101,004 (GRCm39) T46K possibly damaging Het
Prrc2c A T 1: 162,501,725 (GRCm39) probably null Het
Psd3 C T 8: 68,172,620 (GRCm39) A894T probably damaging Het
Pygm A T 19: 6,448,073 (GRCm39) probably null Het
Pzp A T 6: 128,468,560 (GRCm39) M989K probably damaging Het
Ralgapa2 A T 2: 146,203,373 (GRCm39) S1159T probably benign Het
Rapgefl1 T C 11: 98,740,986 (GRCm39) F575L probably benign Het
Rassf6 A G 5: 90,765,627 (GRCm39) L28S probably damaging Het
Rbp3 G T 14: 33,676,857 (GRCm39) K268N probably damaging Het
Rela C T 19: 5,697,092 (GRCm39) T433M possibly damaging Het
Rnf103 T A 6: 71,473,894 (GRCm39) S102R probably damaging Het
Scarf2 A G 16: 17,624,243 (GRCm39) N516S probably damaging Het
Sdcbp2 T C 2: 151,429,403 (GRCm39) I241T probably damaging Het
Septin7 T C 9: 25,199,494 (GRCm39) I131T possibly damaging Het
Sh3pxd2b T C 11: 32,357,570 (GRCm39) F191L probably damaging Het
Siglec15 C A 18: 78,090,590 (GRCm39) C236F probably damaging Het
Slc11a2 T C 15: 100,295,562 (GRCm39) T520A probably benign Het
Slc26a11 C A 11: 119,270,738 (GRCm39) F553L probably benign Het
Smchd1 G A 17: 71,672,404 (GRCm39) P1596S possibly damaging Het
Taar7b A G 10: 23,876,246 (GRCm39) H137R probably damaging Het
Thap12 T A 7: 98,365,237 (GRCm39) C468* probably null Het
Timp4 C T 6: 115,224,315 (GRCm39) G118D probably damaging Het
Tnnt3 A G 7: 142,065,003 (GRCm39) K48E probably damaging Het
Trmt10a T A 3: 137,862,475 (GRCm39) I255N probably damaging Het
Ttll10 T C 4: 156,133,189 (GRCm39) probably null Het
Tut7 T G 13: 59,937,023 (GRCm39) Y806S probably damaging Het
Ube4b A G 4: 149,457,389 (GRCm39) Y283H probably damaging Het
Ucp1 G T 8: 84,020,567 (GRCm39) V126L possibly damaging Het
Unc13b T A 4: 43,172,596 (GRCm39) probably benign Het
Vps13b T C 15: 35,875,918 (GRCm39) S2768P probably damaging Het
Zfp101 T A 17: 33,599,936 (GRCm39) M607L probably benign Het
Zfp292 C T 4: 34,805,464 (GRCm39) V2527M possibly damaging Het
Zfp503 T A 14: 22,035,630 (GRCm39) T429S possibly damaging Het
Other mutations in Prkd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Prkd2 APN 7 16,599,787 (GRCm39) missense probably damaging 1.00
IGL01138:Prkd2 APN 7 16,582,736 (GRCm39) missense probably damaging 1.00
IGL01714:Prkd2 APN 7 16,597,867 (GRCm39) missense probably damaging 1.00
IGL01968:Prkd2 APN 7 16,603,501 (GRCm39) splice site probably null
IGL01969:Prkd2 APN 7 16,599,682 (GRCm39) missense probably damaging 1.00
IGL02354:Prkd2 APN 7 16,581,583 (GRCm39) missense probably damaging 1.00
IGL02361:Prkd2 APN 7 16,581,583 (GRCm39) missense probably damaging 1.00
IGL02504:Prkd2 APN 7 16,591,757 (GRCm39) missense probably damaging 1.00
IGL02804:Prkd2 APN 7 16,589,815 (GRCm39) missense probably benign 0.04
IGL02834:Prkd2 APN 7 16,579,859 (GRCm39) missense probably damaging 0.97
IGL02962:Prkd2 APN 7 16,603,757 (GRCm39) missense probably benign 0.01
IGL03053:Prkd2 APN 7 16,584,188 (GRCm39) missense possibly damaging 0.63
IGL03168:Prkd2 APN 7 16,584,188 (GRCm39) missense possibly damaging 0.63
alila UTSW 7 16,581,579 (GRCm39) missense probably damaging 1.00
Beaches UTSW 7 16,583,128 (GRCm39) nonsense probably null
Purnama UTSW 7 16,603,490 (GRCm39) missense probably damaging 1.00
Sandals UTSW 7 16,599,639 (GRCm39) missense probably damaging 1.00
R0024:Prkd2 UTSW 7 16,581,568 (GRCm39) missense probably damaging 1.00
R0173:Prkd2 UTSW 7 16,582,969 (GRCm39) missense probably benign
R0190:Prkd2 UTSW 7 16,603,815 (GRCm39) missense probably damaging 1.00
R0834:Prkd2 UTSW 7 16,599,602 (GRCm39) splice site probably benign
R1418:Prkd2 UTSW 7 16,603,470 (GRCm39) missense probably benign 0.03
R1488:Prkd2 UTSW 7 16,592,364 (GRCm39) missense probably damaging 1.00
R1648:Prkd2 UTSW 7 16,591,732 (GRCm39) missense possibly damaging 0.51
R2015:Prkd2 UTSW 7 16,581,602 (GRCm39) nonsense probably null
R2042:Prkd2 UTSW 7 16,590,193 (GRCm39) missense possibly damaging 0.86
R2101:Prkd2 UTSW 7 16,603,490 (GRCm39) missense probably damaging 1.00
R3884:Prkd2 UTSW 7 16,587,180 (GRCm39) missense probably benign 0.02
R4601:Prkd2 UTSW 7 16,577,573 (GRCm39) unclassified probably benign
R4979:Prkd2 UTSW 7 16,582,652 (GRCm39) missense probably damaging 1.00
R5240:Prkd2 UTSW 7 16,589,711 (GRCm39) missense probably benign 0.09
R5643:Prkd2 UTSW 7 16,577,717 (GRCm39) missense probably benign 0.02
R6033:Prkd2 UTSW 7 16,599,639 (GRCm39) missense probably damaging 1.00
R6033:Prkd2 UTSW 7 16,599,639 (GRCm39) missense probably damaging 1.00
R6361:Prkd2 UTSW 7 16,581,579 (GRCm39) missense probably damaging 1.00
R6738:Prkd2 UTSW 7 16,599,830 (GRCm39) missense possibly damaging 0.64
R6798:Prkd2 UTSW 7 16,583,128 (GRCm39) nonsense probably null
R6815:Prkd2 UTSW 7 16,577,718 (GRCm39) missense probably benign 0.00
R7241:Prkd2 UTSW 7 16,591,730 (GRCm39) missense probably benign 0.44
R7293:Prkd2 UTSW 7 16,579,865 (GRCm39) missense possibly damaging 0.88
R7323:Prkd2 UTSW 7 16,581,547 (GRCm39) missense probably benign 0.07
R7900:Prkd2 UTSW 7 16,587,269 (GRCm39) missense probably benign 0.01
R7943:Prkd2 UTSW 7 16,584,244 (GRCm39) missense probably benign 0.30
R8723:Prkd2 UTSW 7 16,591,702 (GRCm39) missense possibly damaging 0.90
R8729:Prkd2 UTSW 7 16,583,052 (GRCm39) missense probably damaging 1.00
R8923:Prkd2 UTSW 7 16,599,682 (GRCm39) missense probably damaging 1.00
R9111:Prkd2 UTSW 7 16,584,131 (GRCm39) missense probably benign 0.01
R9222:Prkd2 UTSW 7 16,577,699 (GRCm39) missense probably damaging 0.98
R9466:Prkd2 UTSW 7 16,589,696 (GRCm39) missense probably damaging 1.00
R9564:Prkd2 UTSW 7 16,591,744 (GRCm39) missense possibly damaging 0.92
X0062:Prkd2 UTSW 7 16,589,716 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGAGGTGAGGTAATTAGCATC -3'
(R):5'- TAAAGGCCTGCTCAGCTCAC -3'

Sequencing Primer
(F):5'- GGGATGGATGGAGGCCCTTC -3'
(R):5'- GCCCATCTTAAAGACAGG -3'
Posted On 2017-06-26