Incidental Mutation 'R5994:Thap12'
ID 481003
Institutional Source Beutler Lab
Gene Symbol Thap12
Ensembl Gene ENSMUSG00000030753
Gene Name THAP domain containing 12
Synonyms 2900052B10Rik, Dap4, Prkrir
MMRRC Submission 044173-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.968) question?
Stock # R5994 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 98352310-98367269 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 98365237 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 468 (C468*)
Ref Sequence ENSEMBL: ENSMUSP00000033009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033009] [ENSMUST00000126356] [ENSMUST00000153566]
AlphaFold Q9CUX1
Predicted Effect probably null
Transcript: ENSMUST00000033009
AA Change: C468*
SMART Domains Protein: ENSMUSP00000033009
Gene: ENSMUSG00000030753
AA Change: C468*

DomainStartEndE-ValueType
THAP 3 92 8.38e-22 SMART
DM3 21 91 1.49e-20 SMART
Pfam:DUF4371 112 338 1.9e-22 PFAM
low complexity region 433 445 N/A INTRINSIC
Pfam:Dimer_Tnp_hAT 631 726 6.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126356
SMART Domains Protein: ENSMUSP00000118403
Gene: ENSMUSG00000030753

DomainStartEndE-ValueType
THAP 3 78 3.21e-9 SMART
DM3 21 78 1.89e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146473
Predicted Effect probably benign
Transcript: ENSMUST00000153566
SMART Domains Protein: ENSMUSP00000118736
Gene: ENSMUSG00000030753

DomainStartEndE-ValueType
THAP 3 92 8.38e-22 SMART
DM3 21 91 1.49e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208543
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,647,862 (GRCm39) H1118L probably benign Het
Abca8b A G 11: 109,840,592 (GRCm39) probably null Het
Abcb5 A T 12: 118,928,995 (GRCm39) probably null Het
Adcy6 A T 15: 98,491,545 (GRCm39) I1016N probably damaging Het
Afg3l2 A T 18: 67,562,140 (GRCm39) C312S probably damaging Het
Ano8 C T 8: 71,937,478 (GRCm39) V89M probably damaging Het
Arhgap21 C T 2: 20,886,187 (GRCm39) G330D possibly damaging Het
Caskin1 T C 17: 24,715,935 (GRCm39) L195P probably damaging Het
Cfap54 A G 10: 92,874,943 (GRCm39) I514T probably damaging Het
Ctdsp2 G A 10: 126,831,689 (GRCm39) probably benign Het
Cyp4x1 T C 4: 114,979,142 (GRCm39) I152V probably benign Het
Dglucy G A 12: 100,808,959 (GRCm39) R219Q probably benign Het
Disp3 G T 4: 148,338,741 (GRCm39) A810E possibly damaging Het
Dtx4 T C 19: 12,478,517 (GRCm39) Y22C probably damaging Het
Edaradd A T 13: 12,493,377 (GRCm39) I105N probably damaging Het
Eepd1 C T 9: 25,514,749 (GRCm39) P519S probably damaging Het
Fscn3 A T 6: 28,430,294 (GRCm39) S155C probably benign Het
Gm10134 A T 2: 28,396,258 (GRCm39) E51V probably damaging Het
Gm7247 C T 14: 51,601,805 (GRCm39) S26F probably benign Het
Golga7 T C 8: 23,740,281 (GRCm39) E83G probably benign Het
Gpr12 T C 5: 146,520,241 (GRCm39) H227R probably damaging Het
Hoxa2 T G 6: 52,141,372 (GRCm39) S85R possibly damaging Het
Hrnr T C 3: 93,239,607 (GRCm39) S3282P unknown Het
Ift74 C A 4: 94,579,961 (GRCm39) T543K possibly damaging Het
Klf10 C A 15: 38,296,285 (GRCm39) R420L probably damaging Het
Krt77 T A 15: 101,771,290 (GRCm39) I338F probably damaging Het
Limch1 A T 5: 67,131,965 (GRCm39) S152C probably damaging Het
Mgat4e T A 1: 134,469,234 (GRCm39) H270L probably benign Het
Myrf A T 19: 10,196,481 (GRCm39) L504Q probably null Het
Nckipsd A G 9: 108,691,176 (GRCm39) Q366R probably benign Het
Npy5r A T 8: 67,134,751 (GRCm39) V14D probably benign Het
Nrap T A 19: 56,340,031 (GRCm39) R830* probably null Het
Ogfrl1 A T 1: 23,418,070 (GRCm39) Y103N probably damaging Het
Or10g7 A T 9: 39,905,519 (GRCm39) R138* probably null Het
P2rx4 T A 5: 122,863,142 (GRCm39) L232H probably damaging Het
Pabpc2 A T 18: 39,906,947 (GRCm39) T71S probably benign Het
Paip2b C A 6: 83,785,867 (GRCm39) S121I probably damaging Het
Pofut1 C T 2: 153,103,149 (GRCm39) T261I possibly damaging Het
Ppp6c G T 2: 39,101,004 (GRCm39) T46K possibly damaging Het
Prkd2 C A 7: 16,584,261 (GRCm39) H371Q probably benign Het
Prrc2c A T 1: 162,501,725 (GRCm39) probably null Het
Psd3 C T 8: 68,172,620 (GRCm39) A894T probably damaging Het
Pygm A T 19: 6,448,073 (GRCm39) probably null Het
Pzp A T 6: 128,468,560 (GRCm39) M989K probably damaging Het
Ralgapa2 A T 2: 146,203,373 (GRCm39) S1159T probably benign Het
Rapgefl1 T C 11: 98,740,986 (GRCm39) F575L probably benign Het
Rassf6 A G 5: 90,765,627 (GRCm39) L28S probably damaging Het
Rbp3 G T 14: 33,676,857 (GRCm39) K268N probably damaging Het
Rela C T 19: 5,697,092 (GRCm39) T433M possibly damaging Het
Rnf103 T A 6: 71,473,894 (GRCm39) S102R probably damaging Het
Scarf2 A G 16: 17,624,243 (GRCm39) N516S probably damaging Het
Sdcbp2 T C 2: 151,429,403 (GRCm39) I241T probably damaging Het
Septin7 T C 9: 25,199,494 (GRCm39) I131T possibly damaging Het
Sh3pxd2b T C 11: 32,357,570 (GRCm39) F191L probably damaging Het
Siglec15 C A 18: 78,090,590 (GRCm39) C236F probably damaging Het
Slc11a2 T C 15: 100,295,562 (GRCm39) T520A probably benign Het
Slc26a11 C A 11: 119,270,738 (GRCm39) F553L probably benign Het
Smchd1 G A 17: 71,672,404 (GRCm39) P1596S possibly damaging Het
Taar7b A G 10: 23,876,246 (GRCm39) H137R probably damaging Het
Timp4 C T 6: 115,224,315 (GRCm39) G118D probably damaging Het
Tnnt3 A G 7: 142,065,003 (GRCm39) K48E probably damaging Het
Trmt10a T A 3: 137,862,475 (GRCm39) I255N probably damaging Het
Ttll10 T C 4: 156,133,189 (GRCm39) probably null Het
Tut7 T G 13: 59,937,023 (GRCm39) Y806S probably damaging Het
Ube4b A G 4: 149,457,389 (GRCm39) Y283H probably damaging Het
Ucp1 G T 8: 84,020,567 (GRCm39) V126L possibly damaging Het
Unc13b T A 4: 43,172,596 (GRCm39) probably benign Het
Vps13b T C 15: 35,875,918 (GRCm39) S2768P probably damaging Het
Zfp101 T A 17: 33,599,936 (GRCm39) M607L probably benign Het
Zfp292 C T 4: 34,805,464 (GRCm39) V2527M possibly damaging Het
Zfp503 T A 14: 22,035,630 (GRCm39) T429S possibly damaging Het
Other mutations in Thap12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Thap12 APN 7 98,365,344 (GRCm39) missense possibly damaging 0.82
IGL01145:Thap12 APN 7 98,362,110 (GRCm39) makesense probably null
IGL01973:Thap12 APN 7 98,365,706 (GRCm39) missense possibly damaging 0.58
IGL02404:Thap12 APN 7 98,359,340 (GRCm39) missense probably damaging 1.00
H8562:Thap12 UTSW 7 98,364,314 (GRCm39) missense probably damaging 0.98
PIT4453001:Thap12 UTSW 7 98,364,245 (GRCm39) missense probably benign 0.00
R0090:Thap12 UTSW 7 98,365,100 (GRCm39) missense probably damaging 1.00
R0254:Thap12 UTSW 7 98,364,488 (GRCm39) missense probably benign 0.03
R1344:Thap12 UTSW 7 98,366,037 (GRCm39) missense probably damaging 0.97
R1384:Thap12 UTSW 7 98,352,645 (GRCm39) missense probably damaging 0.98
R1418:Thap12 UTSW 7 98,366,037 (GRCm39) missense probably damaging 0.97
R1448:Thap12 UTSW 7 98,365,230 (GRCm39) missense probably benign 0.01
R1493:Thap12 UTSW 7 98,364,645 (GRCm39) missense probably benign 0.30
R1906:Thap12 UTSW 7 98,365,947 (GRCm39) missense probably damaging 1.00
R1932:Thap12 UTSW 7 98,366,045 (GRCm39) missense possibly damaging 0.77
R1992:Thap12 UTSW 7 98,365,572 (GRCm39) missense possibly damaging 0.68
R2044:Thap12 UTSW 7 98,365,827 (GRCm39) missense probably damaging 1.00
R2092:Thap12 UTSW 7 98,365,656 (GRCm39) missense possibly damaging 0.70
R2160:Thap12 UTSW 7 98,359,333 (GRCm39) missense probably damaging 0.97
R3850:Thap12 UTSW 7 98,365,870 (GRCm39) missense probably damaging 1.00
R4086:Thap12 UTSW 7 98,365,701 (GRCm39) missense possibly damaging 0.94
R4162:Thap12 UTSW 7 98,359,285 (GRCm39) intron probably benign
R4554:Thap12 UTSW 7 98,365,052 (GRCm39) missense probably benign 0.00
R4555:Thap12 UTSW 7 98,365,052 (GRCm39) missense probably benign 0.00
R4556:Thap12 UTSW 7 98,365,052 (GRCm39) missense probably benign 0.00
R4557:Thap12 UTSW 7 98,365,052 (GRCm39) missense probably benign 0.00
R4659:Thap12 UTSW 7 98,359,298 (GRCm39) intron probably benign
R4734:Thap12 UTSW 7 98,365,162 (GRCm39) nonsense probably null
R4734:Thap12 UTSW 7 98,365,161 (GRCm39) missense probably damaging 0.98
R5794:Thap12 UTSW 7 98,365,600 (GRCm39) missense probably benign 0.11
R6298:Thap12 UTSW 7 98,352,612 (GRCm39) missense probably damaging 1.00
R6515:Thap12 UTSW 7 98,356,302 (GRCm39) missense probably damaging 0.97
R6624:Thap12 UTSW 7 98,364,793 (GRCm39) nonsense probably null
R6625:Thap12 UTSW 7 98,365,277 (GRCm39) missense probably benign 0.00
R6965:Thap12 UTSW 7 98,364,669 (GRCm39) missense probably damaging 1.00
R7560:Thap12 UTSW 7 98,359,438 (GRCm39) missense probably damaging 0.99
R8182:Thap12 UTSW 7 98,365,584 (GRCm39) missense probably damaging 1.00
R8713:Thap12 UTSW 7 98,356,283 (GRCm39) missense probably benign 0.30
R8897:Thap12 UTSW 7 98,364,534 (GRCm39) missense probably benign 0.38
R9099:Thap12 UTSW 7 98,364,600 (GRCm39) missense probably damaging 1.00
R9260:Thap12 UTSW 7 98,356,280 (GRCm39) nonsense probably null
R9339:Thap12 UTSW 7 98,364,323 (GRCm39) missense possibly damaging 0.95
R9467:Thap12 UTSW 7 98,359,348 (GRCm39) missense probably damaging 0.99
R9644:Thap12 UTSW 7 98,364,495 (GRCm39) missense probably damaging 0.97
R9789:Thap12 UTSW 7 98,352,592 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- CCACAGCTGCTTTTAGAACTTGAC -3'
(R):5'- TGTGGCTTCCTCAAACCAAAAC -3'

Sequencing Primer
(F):5'- CTTTTTCAGAATAGTGAAGAACGGGC -3'
(R):5'- TGGCTTCCTCAAACCAAAACTCATG -3'
Posted On 2017-06-26